Adipocyte-derived exosomal miR-30c-5p promotes ovarian angiogenesis in polycystic ovary syndrome via the SOCS3/STAT3/VEGFA pathway

Adipocyte-derived exosomes were internalized by HOMECs

Adipogenic differentiation of 3T3-L1 cells was induced to imitate mature adipocytes in vivo. Differentiated 3T3-L1 cells exhibited typical adipocyte phenotypes as indicated by oil red O staining (Figure 1A). Exosomes from differentiated adipocytes were isolated via ultracentrifugation and identified via transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) and western blotting. TEM revealed the presence of vesicles with a bi-layer membrane structure ranging from 30 to 200 nm (Figure 1B). The average diameter of the vesicles was 136.3 nm detected by NTA (Figure 1C). Western blotting revealed the expression of exosome markers, namely, CD9 and CD63, in isolated vesicles. Fatty acid binding protein 4 (FABP4) is a specific marker of adipocyte-derived exosomes [26], which was detected in differentiated 3T3-L1 cells and vesicles (Figure 1D). Above results indicated we successfully isolated adipocyte-derived exosomes. To assess whether HOMCEs can internalize adipocyte-derived exosomes, HOMECs were incubated with PKH-26 labelled exosomes, while PBS was added as the control (CON). After 6 h, PKH26-labelled exosomes were observed in HOMECs (Figure 1E). Altogether, these results indicated that adipocyte-derived exosomes were internalized by HOMECs.

Figure 1. Characterization of adipocyte-derived exosomes. (A) Oil red O staining of differentiated 3T3-L1 cells. (B) TEM analyses of exosomes secreted by adipocytes. (C) NTA of exosomes. (D) Western blotting analyses of exosomal markers (CD9, CD63 and FABP4) in 3T3-L1 cells and adipocyte-derived exosomes. (E) Fluorescence images of HOMECs incubated with PKH26-labelled exosomes (red). The cytoskeleton was stained with phalloidin-FITC (green), and nuclei were stained with DAPI (blue).

Adipocyte-derived exosomes promoted proliferation, migration, and tube formation in HOMECs

To assess the effects of adipocyte-derived exosomes on the biological function of HOMECs, exosomes at different concentrations were added to HOMECs according to the exosome concentrations reported in previous studies [27, 28]. The results of cell counting kit-8 (CCK-8) assay demonstrated that the proliferation rate of HOMECs treated with exosomes was significantly higher than that in the control group (Figure 2A). In addition, the protein expression of Ki67 and proliferating cell nuclear antigen (PCNA) was upregulated in HOMECs treated with exosomes, indicating that adipocyte-derived exosomes strengthened HOMEC proliferation (Figure 2B). Compared with PBS treatment, exosome treatment promoted the migration of HOMECs as indicated by an increased number of migrated cells, upregulation of Vimentin and downregulation of E-cadherin (Figure 2C, 2D). Furthermore, tube formation assay indicated that exosomes enhanced the capillary-like structure formation capacity of HOMECs as indicated by the increased total tube length and number of branches (Figure 2E). Western blotting verified that exosomes enhanced the expression of VEGFA in HOMECs (Figure 2F). Altogether, these results showed that adipocyte-derived exosomes promoted proliferation, migration, and tube formation in HOMECs. Because 20 μg/mL exosomes exerted greater effects on the biological function and protein expression in HOMECs than 10 μg/mL exosomes, the exosome concentration of 20 μg/mL was selected for subsequent cell experiments.

Figure 2. Adipocyte-derived exosomes promote proliferation, migration, and tube formation in HOMECs. (A) Detection of the effect of adipocyte-derived exosomes on the cell proliferation by the CCK-8 assay. (B) Western blotting analyses of Ki67 and PCNA expression in HOMECs. (C) Detection of the effect of adipocyte-derived exosomes on the cell migration by the transwell assay. (D) Western blotting analyses of E-cadherin and Vimentin expression in HOMECs. (E) Detection of the effect of adipocyte-derived exosomes on the cell tube formation by the tube formation assay. (F) Western blotting analyses of VEGFA expression in HOMECs. Data are presented as mean ± SD for three independent experiments. *P<0.05, **P<0.01, ***P<0.001.

miR-30c-5p was delivered by adipocyte-derived exosomes and promoted proliferation, migration, and tube formation in HOMECs

A coculture system was used to verify that adipocyte-derived exosomes delivered miR-30c-5p to HOMECs (Figure 3A). The levels of miR-30c-5p were increased in HOMECs co-cultured with differentiated 3T3-L1 cells but were decreased after adipocytes were treated with the exosome inhibitor GW4869 (Figure 3B). These results indicated that miR-30c-5p was delivered to HOMECs by exosomes. Furthermore, miR-30c-5p mimics/inhibitors/negative controls (NCs) were transfected into HOMECs to investigate the effects of miR-30c-5p on the biological function of HOMECs. The miR-30c-5p levels in HOMECs were significantly increased after transfection of miR-30c-5p mimics while they were decreased after transfection of miR-30c-5p inhibitors (Figure 3C). Subsequently, the role of miR-30c-5p in the proliferation, migration, and tube formation of HOMECs was examined. The results of CCK-8 assay demonstrated that the miR-30c-5p overexpression enhanced the proliferation rate of HOMECs whereas miR-30c-5p inhibition suppressed HOMEC proliferation (Figure 3D). The number of migrated HOMECs was increased after the transfection of miR-30c-5p mimics but decreased after the transfection of miR-30c-5p inhibitors (Figure 3E, 3F). In addition, tube formation assays suggested miR-30c-5p enhanced capillary-like structure formation capacity of HOMECs (Figure 3G, 3H).

Figure 3. miR-30c-5p is delivered by adipocyte-derived exosomes and promotes proliferation, migration, and tube formation in HOMECs. (A) Coculture of HOMECs and adipocytes treated with or without GW4869. (B) qRT-PCR detection of miR-30c-5p levels in HOMECs in the coculture system. (C) qRT-PCR detection of miR-30c-5p levels after cell transfection. (D) Detection of the effect of miR-30c-5p on the cell proliferation by the CCK-8 assay. (E, F) Detection of the effect of miR-30c-5p on the cell migration by the transwell assay. (G, H) Detection of the effect of miR-30c-5p on the cell tube formation capacity by the tube formation assay. Data are presented as mean ± SD for three independent experiments. *P<0.05, **P<0.01, ***P<0.001.

miR-30c-5p activated the STAT3/VEGFA pathway by targeting SOCS3

To determine the mechanism of miR-30c-5p regulating biological function of HOMECs, the target genes of miR-30c-5p were predicted via bioinformatic analysis. The results indicated that SOCS3 was one of the 12 target genes of miR-30c-5p jointly predicted by TargetScan, miRDB and Starbase (Figure 4A, 4B). TargetScan predicted that the 3’-UTR of the SOCS3 mRNA was the conserved binding site of miR-30c-5p (Figure 4C). Furthermore, the results of dual luciferase reporter assay showed that the transfection of miR-30c-5p mimics reduced the luciferase activity in HOMECs transfected with pmirGLO-SOCS3-WT instead of pmirGLO-SOCS3-MUT (Figure 4D). These results indicated that miR-30c-5p inhibited the transcription of SOCS3 by directly binding to the 3’-UTR of SOCS3 mRNA.

Figure 4. SOCS3 is a target gene of miR-30c-5p. (A, B) Bioinformatic analyses of target genes of miR-30c-5p. (C) Prediction of the binding site of miR-30c-5p in the 3’-UTR of SOCS3 mRNA by TargetScan. (D) Confirmation of the targeting relationship between miR-30c-5p and SOCS3 by the dual luciferase reporter assay. Data are presented as mean ± SD for three independent experiments. ***P<0.001.

SOCS3 can indirectly inhibit the transcription of VEGFA by inhibiting STAT3 [29, 30]. Therefore, the effects of miR-30c-5p on the SOCS3/STAT3/VEGFA pathway were further investigated. Western blotting showed that overexpression of miR-30c-5p suppressed the expression of SOCS3 and promoted the expression of p-STAT3 and VEGFA, whereas miR-30c-5p inhibition significantly upregulated the expression of SOCS3 and inhibited the expression of p-STAT3 and VEGFA (Figure 5A). Furthermore, HOMECs were co-transfected with miR-30c-5p mimics and SOCS3 plasmid to investigate the effects of the miR-30c-5p/SOCS3 axis on the STAT3/VEGFA pathway. The results showed transfection of only miR-30c-5p mimics led to downregulation of SOCS3 and upregulation of p-STAT3 and VEGFA, while this effect was reversed after co-transfection with the SOCS3 plasmid (Figure 5B). Therefore, these results suggest that miR-30c-5p activates the STAT3/VEGFA pathway by targeting SOCS3.

Figure 5. miR-30c-5p regulates the expression of the SOCS3/STAT3/VEGFA pathway. (A) Western blotting analyses of the effect of miR-30c-5p on SOCS3/STAT3/VEGFA pathway expression in HOMECs. (B) Western blotting analyses of the effect of SOCS3 on STAT3/VEGFA pathway expression in HOMECs. Data are presented as mean ± SD for three independent experiments. ***P<0.001.

Adipocyte-derived exosomal miR-30c-5p promoted proliferation, migration, and tube formation in HOMECs and activating the SOCS3/STAT3/VEGFA pathway

To verify whether miR-30c-5p mediates the effects of adipocyte-derived exosomes on the biological function of HOMECs, HOMECs were co-treated with miR-30c-5p inhibitors and adipocyte-derived exosomes. qRT-PCR showed that exosome treatment enhanced the levels of miR-30c-5p in HOMECs, whereas this effect was mitigated after co-treatment with miR-30c-5p inhibitors (Figure 6A). Furthermore, the effects of exosomal miR-30c-5p on the proliferation of HOMECs were examined, and the results revealed that miR-30c-5p inhibitors reversed the stimulative effects of exosomes on the proliferation of HOMECs (Figure 6B). In addition, wound healing assay indicated that miR-30c-5p inhibitors reversed the stimulative effects of exosomes on the migration of HOMECs (Figure 6C). Moreover, tube formation ability of HOMECs simultaneously treated with exosomes and miR-30c-5p inhibitors was weaker than that of HOMECs treated with only exosomes (Figure 6D). Western blotting revealed that exosomes stimulated p-STAT3 and VEGFA expression and suppressed SOCS3 expression in HOMECs, while these effects were alleviated after miR-30c-5p inhibition (Figure 6E).

Figure 6. miR-30c-5p mediates the effects of adipocyte-derived exosomes on the biological function of HOMECs and the SOCS3/STAT3/VEGFA pathway. (A) qRT-PCR detection of the effect of exosomes combined with or without miR-30c-5p inhibitors on miR-30c-5p levels in HOMECs. (B) Detection of the effect of exosomal miR-30c-5p on the cell proliferation by the CCK-8 assay. (C) Detection of the effect of exosomal miR-30c-5p on the cell migration by the wound healing assay. (D) Detection of the effect of exosomal miR-30c-5p on the cell tube formation capacity by the tube formation assay. (E) Western blotting analyses of the effect of exosomal miR-30c-5p on SOCS3/STAT3/VEGFA pathway expression in HOMECs. Data are presented as mean ± SD for three independent experiments. *P<0.05, ** P<0.01, ***P<0.001.

Adipocyte-derived exosomal miR-30c-5p exacerbated endocrine and metabolic disorders in mice with PCOS

To verify the abovementioned findings in vivo, dehydroepiandrosterone (DHEA) was used to induce PCOS in mice, and mice with PCOS were treated with adipocyte-derived exosomes and miR-30c-5p antagomir via tail vein injection (Figure 7A). DHEA-treated mice exhibited a disordered estrous cycle and weight gain, with the formation of cystic follicles (CFs) and deterioration of corpus luteum (CL) in the ovaries, indicating the establishment of PCOS models (Supplementary Figure 1A–1C). Immunofluorescence (IF) analyses of the ovaries showed that exosomes in blood circulation were taken up by the ovaries (Figure 7B). miR-30c-5p levels of the ovaries were increased in mice with PCOS. In the exosome-treated groups, exosome treatment alone increased miR-30c-5p levels in the ovaries of PCOS mice, but this effect was mitigated after co-treatment with miR-30c-5p antagomir. (Figure 7C). Notably, exosome treatment combined with or without miR-30c-5p antagomir had no significant effect on the estrous cycle of PCOS mice (Figure 7D). Additionally, PCOS mice gained weight after exosome treatment for 2 weeks, while miR-30c-5p antagomir alleviated this effect (Figure 7E). Furthermore, the glucometabolic state of mice in different groups was evaluated. The results demonstrated that miR-30c-5p antagomir mitigated the effects of exosomes on aggravating insulin resistance in PCOS mice (Figure 7F–7H). Exosome treatment downregulated serum follicle-stimulating hormone (FSH) levels and upregulated serum estradiol (E₂), testosterone (T) and VEGFA levels in PCOS mice. However, miR-30c-5p antagomir attenuated these changes (Figure 7I–7L). These results indicate that adipocyte-derived exosomes exacerbate endocrine and metabolic disorders in PCOS via miR-30c-5p.

Figure 7. Adipocyte-derived exosomal miR-30c-5p exacerbates endocrine and metabolic disorders in mice with PCOS. (A) Procedure of animal experiments. (B) Visualization of uptake of exosomes by the ovaries in vivo. (C) qRT-PCR detection of miR-30c-5p levels in the ovaries of mice in the indicated groups. (D) Estrous cycle analyses of mice in each group via vaginal smears. (E) Weight change in the indicated groups after administration of exosomes and miR-30c-5p antagomir for 1 and 2 weeks. (F) Fasting insulin levels in the indicated groups. (G) Fasting glucose levels in the indicated groups. (H) HOMA-IR index in the indicated groups. HOMA-IR = fasting insulin × fasting glucose/22.5. (I–L) ELISA detection of serum E₂, FSH, T and VEGFA levels in the indicated groups. Proestrus (P), estrus (E), metestrus (M) and diestrus (D). Data are presented as mean ± SD for three independent experiments. *P<0.05, ** P<0.01, ***P<0.001.

Adipocyte-derived exosomal miR-30c-5p mediated ovarian angiogenesis through the SOCS3/STAT3/VEGFA pathway

In in vivo experiments, exosome treatment increased the number of CFs and deteriorated CL in the ovaries of PCOS mice. Nevertheless, miR-30c-5p antagomir attenuated these changes (Figure 8A). Ovarian angiogenesis was determined via immunohistochemical (IHC) analyses, which suggested that adipocyte-derived exosomes facilitated ovarian angiogenesis as shown by the downregulation of SOCS3 and upregulation of CD31 and VEGFA expression in ovaries. In addition, compared with PCOS mice treated with only exosomes, ovarian angiogenesis was inhibited in mice simultaneously treated with exosomes and miR-30c-5p antagomir (Figure 8B). Western blotting indicated adipocyte-derived exosomes suppressed SOCS3 expression and upregulated p-STAT3 and VEGFA expression in the ovaries of PCOS mice. Moreover, miR-30c-5p antagomir partially reversed the effects of adipocyte-derived exosomes on the expression of the SOCS3/STAT3/VEGFA pathway in ovaries (Figure 8C).

Figure 8. Adipocyte-derived exosomal miR-30c-5p mediates ovarian angiogenesis through the SOCS3/STAT3/VEGFA pathway. (A) Visualization of the ovarian morphology in the indicated groups by HE staining. (B) Detection of SOCS3, CD31 and VEGFA expression in the ovaries in the indicated groups by IHC staining. (C) Western blotting analyses of the SOCS3/STAT3/VEGFA pathway expression in the indicated groups. Primary follicles (PFs), granulosa cells (GCs), theca cells (TCs), secondary follicles (SFs), antral follicles (AFs), corpus luteum (CL), and cystic follicles (CFs). Data are presented as mean ± SD for three independent experiments. *P<0.05, ** P<0.01, ***P<0.001.

Cell line and culture

Preadipocyte 3T3-L1 cells were obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS, 10099141c, Gibco) and 1% penicillin–streptomycin (Biosharp). HOMECs were obtained from Zhongqiaoxinzhou Biotechnology Co. and cultured in Endothelial Cell Medium (1001, Zhongqiaoxinzhou Biotechnology Co.) containing 5% fetal bovine serum, 1% endothelial cell growth supplement and 1% penicillin–streptomycin. All cells were cultivated in a 5% CO₂ incubator at 37° C.

Adipogenic differentiation

For adipogenic differentiation, 2 days after confluence (day 0), 3T3-L1 cells were incubated in DMEM containing 10% FBS, 1 μM dexamethasone (D4902, Sigma-Aldrich), 0.5 mM 1-methyl-3-isobutylxanthine (I7018, Sigma-Aldrich) and 10 μg/mL insulin (I5500, Sigma-Aldrich) for 4 days. On day 4, the medium was replaced with DMEM containing 10% FBS and 10 μg/mL insulin for 2 days. Afterwards, the cells were maintained in DMEM containing 10% FBS until day 12. All medium was changed every 2 days.

On day 12, differentiated 3T3-L1 cells were washed twice with PBS and fixed in 4% paraformaldehyde for 20 min. Subsequently, the cells were stained with 60% oil red O (3:2, oil red O saturated solution in isopropanol:distilled water) for 30 min at room temperature. The stained cells were photographed using an inverted microscope (IX51, Olympus).

Exosome isolation and identification

On day 12 of adipogenic differentiation, the medium was replaced with DMEM containing 10% exosome-depleted FBS (EXO-FBS-50A-1, System Biosciences), where differentiated 3T3-L1 cells were cultured for 48 h. The supernatant was collected and centrifuged at 1,000 ×g for 10 min, 3,000 ×g for 30 min and 10,000×g for 20 min at 4° C to separate cell components and fragments. The supernatant from the final centrifugation was ultracentrifuged at 100,000×g for 1 h at 4° C, and then the exosome pellet was resuspended in PBS and centrifuged at 100,000×g for another 1 h at 4° C [45]. Thereafter, exosomes were resuspended in PBS for further use.

For exosome identification, TEM (HT77000, Hitachi) was applied to determine the morphological features of exosomes. In addition, western blotting was used for detecting the specific exosome markers CD9, CD63 and FABP4. Meanwhile, NTA was used for measuring the particle size and concentration of exosomes using the ZetaView system (PMX 110, Particle Metrix).

In vitro exosome uptake assay

Exosomes were labelled with the red fluorescence dye PKH26 (MX4021, MKbio) according to the manufacturer’s instructions. HOMECs were cultured with PKH26-labelled exosomes for 6 h in shade and fixed in 4% paraformaldehyde for 30 min. The cytoskeletons of cells were stained with fluorescein isothiocyanate (FITC)-labelled phalloidin (40735ES75, YEASEN), and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, AS1075, ASPEN). The images were captured using an inverted fluorescent microscope (IX51, Olympus).

Cell counting kit-8 assay

Cells in the logarithmic growth phase were suspended in serum-free medium, seeded in 96-well plates at a density of 1×10³ cells/well and cultured overnight. The serum-free medium was replaced with a medium containing 10% exosome-depleted FBS on the following day, and the cells were incubated for 0, 12, 24, 48 and 96 h. Subsequently, the CCK-8 (C0038, Beyotime) reagent was added, and then the cells were placed in an incubator at 37° C for 2 h. The optical density value was recorded on a microplate reader (Ensight, Perkin Elmer) at a wavelength of 450 nm.

Transwell assay

Transwell assay was performed in transwell chambers with a pore size of 8.0 μm (3422, Corning). Briefly, 2 × 10⁴ HOMECs suspended in 200 μL of serum-free medium were added to the upper chamber, and 600 μL of medium containing 10% exosome-depleted FBS was added to the lower chamber. The cells were incubated at 37° C for 24 h. Subsequently, the medium was removed, and 4% paraformaldehyde was used to fix the cells for 30 min. The cells were stained with 0.1% (w/v) crystal violet for 10 min, and the migrated cells were visualized and imaged using an optical microscope.

Wound healing assay

For wound healing assay, 2 × 10⁵ cells/well were seeded in a 6-well plate and grown to confluence. The monolayer was scratched using a pipette tip, and then the detached cells were removed using serum-free medium. Thereafter, the cells were cultured in medium supplemented with 10% exosome-depleted FBS at 37° C for 24 h and photographed at 0 h and 24 h after the scratch. Wound closure was calculated as follows: wound recovery area (%) = (A₀ – A₁)/A₀ × 100, where A₀ represents the initial wound area, and A₁ represents the wound area at the time of measurement.

Tube formation assay

Tube formation assay was performed for determining the capillary-like structure formation capacity of HOMECs. Thawed Matrigel matrix (354248, Corning) was added to a 96-well plate and incubated at 37° C for 1 h. Thereafter, the cells were seeded in a 96-well plate at a density of 2 × 10⁴ cells/well and incubated at 37° C. After 6 h, capillary-like structure formation was observed using an inverted microscope.

Coculture

A transwell system (3412, Corning) was used for coculture of differentiated adipocytes and HOMECs. In the coculture experiments, differentiated adipocytes were cultured in the upper chambers, and GW4869 (MedChemExpress) was added to block the secretion of exosomes from adipocytes. Then HOMECs were seeded in the bottom chambers and cocultured with adipocytes for 48 h. qRT-PCR was used to detect the levels of miR-30c-5p in HOMECs.

Cell transfection

miR-30c-5p mimics, inhibitors and the corresponding NCs were obtained from RiboBio Co.. Cells were cultured in a 6-well plate until 70% confluence was achieved. The transfection reagent was prepared by adding the miRNA mimics, inhibitors, or NCs and Lipofectamine 2000 (Lipo 2000, Invitrogen) to serum-free medium, which was incubated at room temperature for 15 min. Subsequently, the reagent was added to each group of cells and incubated at 37° C for 24 h. Transfected cells were treated with fresh medium for 4–6 h before further analyses [46].

The SOCS3 plasmid (pEnCMV-SOCS3[human]-6×His-SV40-Neo) and control vector (pEnCMV-MCS-6×His-SV40-Neo) were obtained from MiaoLing Biotechnology Co.. The transfection method mentioned above was also applied for plasmid transfection and co-transfection of miR-30c-5p mimics with the SOCS3 plasmid.

Bioinformatic analysis

The target genes of miR-30c-5p were jointly predicted using TargetScan (http://www.targetscan.org/vert_71/), Starbase (https://starbase.sysu.Edu.cn/index.php) and miRDB (http://mirdb.org/). Evenn (http://www.ehbio.com/test/venn/#/) was used to combine the data and determine potential target genes. TargetScan was used to identify the seed sequences and regions of potential base-pairing of the target gene.

Dual luciferase reporter assay

The 3’-UTR of the SOCS3 gene was cloned into a dual luciferase reporter vector (Genepharma), referred to as pmirGLO-SOCS3-WT, and a mutant type of the SOCS3 3’-UTR reporter plasmid (pmirGLO-SOCS3-MUT) was also generated by altering the seed region. pmirGLO-SOCS3-WT/MUT was co-transfected with miR-30c-5p mimics into HOMECs using Lipofectamine 2000 for 48 h. Finally, the dual luciferase reporter gene assay kit (Genepharma) was used to measure the binding activity of miR-30c-5p based on firefly/renilla luciferase activity.

Animals and experimental protocol

Female C57BL/6J mice (N=42, 21 days old) were raised at a controlled temperature between 22 and 24° C, with free access to food and water. The PCOS model group (N=32) was subcutaneously injected with dehydroepiandrosterone (DHEA) (6 mg/100 g weight in sesame oil) daily for 21 days to induce PCOS [47]. The control group (CON, N=10) was injected with sesame oil. The establishment of PCOS models was determined by weight, estrous cycle, and ovarian morphology. DHEA-induced PCOS mice were divided into the following three groups: PCOS control group(N=10), PCOS+EXO group (N=12) and PCOS+EXO+miR-30c-5p antagomir group (N=10). Exosomes (30 μg in 200 μL PBS) and miR-30c-5p antagomir (10 mg/kg) were injected into PCOS mice twice a week via the tail vein for 2 weeks [48, 49]. During the treatment period, the mice were weighed weekly, and the estrous cycle was assessed daily via vaginal smears from the 10th day of the first DHEA injection until the end of the experiment. At the end of the treatment period, fasting blood glucose levels were measured via the tail vein after 12 h of fasting using a blood glucose meter (Sinocare). Thereafter, the blood of all mice was collected from the heart using a 1 mL syringe under isoflurane anaesthesia. Serum samples were collected via centrifugation and stored at −80° C for further analyses, and the ovaries were removed for conducting additional experiments. All protocols and experiments were approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University.

In vivo exosome uptake assay

For verification of adipocyte-derived exosomes being taken up by ovaries, PKH26-labeled exosomes were injected into PCOS mice via tail vein. After 24h, the mice were sacrificed, and the ovaries were collected for further IF analyses. For IF staining, the harvested sections were incubated with the primary antibody CD31 (sc-376764, Santa Cruz, 1:100). Subsequently, the sections were incubated with Alexa Fluor 488-conjugated secondary antibody and stained with DAPI for visualization. The fluorescence expression of CD31, DAPI and PKH26-labelled exosomes was determined using a fluorescence microscope.

Ovarian morphology

The ovaries were incubated with paraformaldehyde, dehydrated with ethanol of different concentrations, and embedded with paraffin wax. The maximum cross-section of the ovaries was cut and stained with haematoxylin and eosin (HE). The follicles were classified as primary follicles (PFs) with one layer of cubical granulosa cells (GCs), secondary follicles (SFs) with two or more layers of GCs and antral follicles (AFs) based on the presence or absence of an antrum and CL. CFs contain an attenuated GC layer and thickened theca interna cell layer with a large antrum or a large fluid-filled structure [50].

Elisa

The levels of VEGFA, E₂, T, FSH and insulin in the serum were measured using sandwich ELISA kits (Servicebio, Wuhan, China) according to the manufacturer’s instructions. Each sample was measured in duplicate.

Immunohistochemical

For IHC staining, tissue sections were deparaffinized and rehydrated with xylene and ethanol. The endogenous peroxidase activity was blocked using H₂O₂ in PBS, and non-specific binding was blocked using 5% BSA. Subsequently, the sections were incubated with biotinylated IgG (ASPEN), followed by incubation with the primary antibodies CD31 (#92841, CST, 1:200), VEGFA (ab52917, Abcam, 1:100) and SOCS3 (ab280884, Abcam, 1:1000). Finally, the sections were visualized using the chromogenic substrate diaminobenzidine, and an optical microscope (BX51, Olympus) was used to capture images of the stained sections.

qRT-PCR analysis

Total RNA in cells and the ovaries was isolated using the TRIzol reagent (Life Technology), and cDNA for miRNAs was synthesised using the miRNA First Strand cDNA Synthesis kit (Sangon) according to the manufacturer’s instructions. qRT-PCR was performed using a miRNA qPCR Kit (Sangon) with the forward primer and the universal reverse primer of miR-30c-5p (Sangon). Gene expression was evaluated using the 2^-ΔΔCT method [51], and U6 was used to normalize the relative expression of miR-30c-5p. The primer sequences used are as follows: miR-30c-5p forward primer, 5'-GCTGCGTGTAAACATCCTACACT-3'; reverse primer, 5'-AGTGCAGGGTCCGAGGTATT-3' and U6 forward primer, 5'- CTCGCTTCGGCAGCACA-3'; reverse primer, 5'- AACGCTTCACGAATTTGCGT -3'.

Western blotting analysis

Cell and tissue proteins were extracted using Radio Immunoprecipitation Assay (RIPA) buffer (ASPEN). The concentrations of proteins were detected by a BCA Protein Assay Kit (P0010, Beyotime) according to the manufactures’ instructions. Protein extracts were separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% milk in Tris-buffered saline containing 0.1% Tween-20 for 1 h at room temperature. Subsequently, the membranes were incubated with primary antibodies at 4° C overnight, followed by incubation with horseradish peroxidase (HRP)-labelled secondary antibodies at 37° C for 1 h. The antibodies included rabbit anti-CD9 (ab92726, Abcam, 1:1000), mouse anti-CD63 (sc-5275, Santa Cruz, 1:500), rabbit anti-FABP4 (ab92501, Abcam, 1:2000), rabbit anti-Ki67 (ab16667, Abcam, 1:500), rabbit anti-PCNA (#13110, CST, 1:1000), rabbit anti-Vimentin (#5741, CST, 1:500), mouse anti-E-cadherin (#14472, CST, 1:500), rabbit anti-VEGFA (ab46154, Abcam, 1:1000), rabbit anti-SOCS3 (ab280884, Abcam, 1:1000), rabbit anti-STAT3 (sc-8019, Santa Cruz, 1:500), rabbit anti-p-STAT3 (sc-8059, Santa Cruz, 1:500), HRP-labelled goat anti-rabbit (ASPEN) and HRP-labelled goat anti-mouse (ASPEN) antibodies. Rabbit anti-GAPDH (ab37168, Abcam, 1:10000) and rabbit anti-β-actin (ab8227, Abcam, 1:5000) were used as the internal reference. The immunoreactive bands were visualized on an ECL-Plus western blotting detection system (Thermo Fisher Scientific). The ratio of the grey value of the target band to the internal reference band was used to assess the relative expression of the protein.

Statistical analysis

All data were analyzed using the SPSS Statistics (version 26.0) (IBM) and Prism 9 (GraphPad) software. Data were expressed as mean ± standard deviation (SD) of at least three independent experiments. Student’s t-test was used to compare data between two groups, and one-way ANOVA followed by Tukey’s multiple comparison test was used to compare data among multiple groups. Statistical significance was established at *P < 0.05 versus the indicated group.

Data availability

All data generated or analyzed during this study are included in this published article.