NEAT1 variant 1 weakens the genome-wide effect of miR-3122 on blocking H3K79me3 in bladder cancer

Binding RNA profiling of NEAT1 in BC cells

First, we incubated biotin-labelled NEAT1.1 and NEAT1.2 with cell lysate of bladder cancer cell T24 cells, and performed RNA pull down and next generation sequencing to investigate the binding RNAs with NEAT1. Compared to the negative control of unmatched RNA with biotin, data showed a series of binding RNA with NEAT1. We observed that NEAT1.1 could capture 85 miRNAs, 55 lncRNAs, 39 mRNAs and 3 other RNAs, while NEAT1.2 could obtain 101 miRNAs, 72 lncRNAs, 45 mRNAs and 3 other RNAs (log₂FC > 1, p < 0.05). Although 3.7 kb NEAT1.1 was completely included in 22.7 kb NEAT1.2, the binding RNAs were still different. In total 73 RNAs showed the binding distinction between NEAT1.1 and NEAT1.2 (Figure 1A). In this list of differential binding RNAs, nearly all of them were expressed in nucleus and chromatin (Figure 1B) according to database of “RNALOCATE” [11]. Furthermore, we also found that the distinctions of RNA binding substances between these two variants were mainly expressed in nucleus rather than cytoplasm. In summary, we characterized the binding RNA profiles of NEAT1 in BC T24 cells.

Figure 1. Binding RNA profiles of NEAT1 in T24 BC cells. (A) Grey spots represent RNAs which significantly interact with NEAT1.1 and NEAT1.2 compared to blank biotin IgG (log₂FC > 1, p < 0.05). Blue spots represent the ones only interact with NEAT1.1, whereas red spots are only for NEAT1.2. The spot of miR-3122 is highlighted. (B) The different categories of binding RNAs are listed according to the cellular localization. The spots in (A) are listed in red and blue fonts accordingly.

The intercrossing between miR-3122 and NEAT1.1

Next, we picked up miR-3122, which had the most significant in differential binding RNAs (p = 3.4x10^-8). Our FISH assay validated that miR-3122 and NEAT1.1 had a substantial interaction with each other instead of NEAT1.2 (Figure 2A). Furthermore, we also determined that miR-3122 could bind with 1901 to 2800 of NEAT1.1 (Figure 2B–2E) as we prepared the different truncation of NEAT1.1 (Figure 2F). Taken together, we demonstrated the intercrossing between miR-3122 and NEAT1.1.

Figure 2. The interaction between NEAT1.1 and miR-3122. FISH assay shows the contacts with miR-3122 and wild type NEAT1.1 (A), NEAT1.1 with 1-800 truncation (B), 801-1900 truncation (C), 1901-2800 truncation (D), 2801-3705 truncation (E) in T24 cells with 200 x magnification. Red signals indicate NEAT1.1, and green signals indicate miR-3122. Yellow signals mean the overlapping of these two probes. (F) The schematic representation of NEAT1.1 with truncation of each fragment.

Mono-methylation of H3K79 inhibited by miR-3122

We had found that miR-3122 was mainly expressed in nucleus, it did not look like regular studies looking for mRNA targets in the cytoplasm. To investigate the epigenetic role of miR-3122 in nucleus of BC cells, we performed dot plot assay to study the histone modifications. From the pattern of histone H3 methylation, we unexpectedly observed that histone H3K79me3 was significantly reduced after miR-3122 overexpression, and rescued by NEAT1.1 additional compensation in T24 cells (Figure 3A), which was further verified in BIU-87 and EJ-1 cells (Figure 3B, 3C). Nonetheless, we failed to find that miR-3122 could interfere with expression of H3K79 methyltransferase disruptor of telomeric silencing-1 like (DOT1L) (Figure 3D–3F).

Figure 3. miR-3122 affects global H3K79me3 in BC cells. Dot plot assay show the global levels of H3K4me3, H3K9me3, H3K27me3 and H3K79me3 in T24 (A), BIU-87 (B) and EJ-1 (C) cells with ectopic miR-3122 and NEAT1.1 over-expression. The expression of H3K79 methyltransferase DOT1L in T24 (D), BIU-87 (E) and EJ-1 (F) cells with ectopic miR-3122 and NEAT1.1 over-expression.

Similarly with molecular fishing of NEAT1, biotin-labelled miR-3122 was used to search the binding protein by mass spectrum in T24 cells, and we harvested histone H3 as one of the top plausible binding proteins with K79 trimethylation (Figure 4A). Consistently, RNA immunoprecipitation assay was conducted to validate the intercrossing between miR-3122 and histone H3 in T24, BIU-87 and EJ-1 cells. We found that H3K79me3 could obtain the highest enrichment of miR-3122 compared to other H3 histone modifications (Figure 4B), indicating that H3K79me3 was attributed to miR-3122. Overall, we determined that miR-3122 would affect genome-wide H3K79me3 to regulate gene transcription.

Figure 4. miR-3122 enriches the histone H3 with robust H3K79me3 modification. (A) Representative MS2 spectra shows H3 protein in T24 cells. Inset: Fragmentation patterns of b and y ions show sequence information, amino acid residue, m/z and charge state identified by LC-MS/MS. (B) RIP-qPCR assay shows the enrichment of miR-3122 in histone 3 with different lysine methylation in T24, BIU-87 and EJ-1 BC cells. The p-values represent the statistical significance compared with K3K79me3 or IgG according to different color fonts via One-way ANOVA analysis.

Cell culture

Bladder cancer cell T24, BIU-87 and EJ-1 cells were purchased from Type Culture Collection of the Chinese Academy of Sciences (Beijing, China) were cultured in 1640 medium with 10% FBS (HyClone, USA) at the incubator with 37° C, 5% CO2 and 100% humidity.

RNA synthesis in vivo

Full or truncated single-strand RNA products of NEAT1.1 and miR-3122 labelled by biotin were synthetized by Genepharma (Shanghai, China). Full length of NEAT1.2 was initially amplified by PCR using forward primer adding T7 promoter sequence. PCR products were purified as a template for RNA synthesis using T7 RNA polymerase kit (Cat. No. M0251L, NEB, USA). In the reaction system preparation, uridine nucleoside triphosphate (UTP) was replaced by the specific biotin labelled UTP (Cat. No. AM8451, Thermo Fisher Scientific, USA). DNase I (Cat. No. M0303S, NEB) was used for template removal, followed by ethanol precipitation. RNA products were examined the concentration and subpackaged to store at -80° C for the subsequent experiments.

RNA pull down assay

400 μL streptavidin magnetic beads (Cat. No. S1420, NEB) for each experiment was washed by 1x binding & washing buffer (5 mM Tris-HCl, 0.5 M EDTA, 1 M NaCl, 0.025% Tween 20, 100 U/mL RNase inhibitor) for three times, then added 400 μL 2x binding & washing buffer and 2 μg RNA products for total 800 μL volume. The RNA-beads mixture was rotated gently for 20 min at room temperature, and washed again for three times, followed by cell lysis buffer (1 mM HEPES, 200 mM NaCl, 1% Triton X-100, 10 mM MgCl₂, 1 mM DTT, 1x protease and phosphatase inhibitor cocktail, 1 U/μL RNase inhibitor) for resuspending to 500 μL [25, 26].

1×10⁷ cells were treated by 200 μL cell lysis buffer for 30 min on ice with the gently and repeatedly pipette-blowing, and added the freshly prepared RNA-beads mixture for 2-hrs gentle rotation at 4° C. After that, beads were washed by 400 μL cell lysis buffer for five times. For next generation sequence, beads were resuspended by 1 mL Trizol for RNA isolation. The final purified RNA was used for library construction. For mass spectrum, beads were resuspended by 1x protein loading buffer. Proteins were processed under metal bath at 100° C for 10 min, and the supernatant was transferred to a new tube without beads. Mass spectrum service is provided by Shanghai OEbiotech (Shanghai, China).

Dot plot

1×10⁷ cells were treated by 400 μL cell lysis buffer containing 1x protease and phosphatase inhibitor cocktail for 30 min on ice with the gently and repeatedly pipette-blowing, then centrifuged with 14000 rpm for 15 min at 4° C. The total protein supernatant was determined the concentration, and dropped 2 μl each on nitrocellulose membrane with 2-fold serially dilution (0, 5, 10 and 20 μg) for dot blot assay. The membrane was dried and incubated with H3K4me3 (Cat. No. 61379, Activemotif, USA), H3K9me3 (Cat. No. 39285, Activemotif), H3K27me3 (Cat. No. 61017, Activemotif), H3K79me3 (Cat. No. NB21-1383, Novus, USA) for 4° C overnight with gentle shaking. The membranes were washed by TBST three times at room temperature, followed by rabbit anti-mouse or donkey anti-rabbit IgG-HRP (1:10000 dilution, Beyotime Biotechnology, China) in 10 ml of TBST for 1 h at room temperature with gentle shaking, and washed again for three times. After that membranes were incubated with 3 ml of ECL Western Blotting Substrate (Beyotime Biotechnology, China) for 5 min in darkness at room temperature and developed the spots.

RNA immunoprecipitation assay

As previously described [27–32], 1×10⁷ cells were harvested, resuspended in nuclear isolation buffer (1.28 M sucrose, 40 mM Tris-HCl, 20 mM MgCl₂, 4% Triton X-100) and kept on ice for at least 30 min with frequent mixing. The pellet nuclei were centrifuged with 14000 rpm for 15 min, resuspended by wash buffer (150 mM KCl, 25 mM Tris pH 7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40, 100 U/mL RNAase inhibitor, 1x protease and phosphatase inhibitor cocktail and sheared the chromatin through sonication by high power, 5 s on, 30 s off for 30 cycles. After that, 90% nuclei were incubated with 1 μg antibodies of H3K4me3, H3K9me3, H3K27me3 or H3K79me3 overnight and 40 μL Protein A/G beads (Thermo Fisher Scientific) 2 h by gentle rotation at 4° C while the rest of 10% were harvested as input. The pellet beads were centrifuged by 3000 rpm 3 min, washed three times. Both the input and pellet beads were purified by RNAiso plus (Takara, Japan) and conducted reverse transcription using QuantiTect Reverse Transcription Kit (Qiagen, Germany). Primer sequence for miR-3122: 5’- ACCAGCTCTGTTGGGACAAGAGGAC -3’; 5’- ACCAGCTCTCTTCGGACAAGATGA -3’.

Western blot assay

1×10⁷ cells were treated by 400 μL cell lysis buffer containing 1x protease and phosphatase inhibitor cocktail for 30 min on ice with the gently and repeatedly pipette-blowing, then centrifuged with 14000 rpm for 15 min at 4° C. The total protein supernatant was determined the concentration. 40 μg total protein for each sample was added 1x protein loading buffer, and processed under metal bath at 100° C for 10 min, followed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE). Proteins were transferred to polyvinylidene fluoride membranes. The membranes were then blocked by 5% non-fat milk TBS for 90 min and then incubated with the respective primary antibodies of DTO1L (1:2000, Cat. No. NB100-40845, Novus) and β-Actin (1:5000, Cat. No. AF5001, Beyotime Biotechnology) overnight at 4° C. Membranes were washed in TBST and incubated with rabbit anti-mouse and goat anti-rabbit IgG-HRP at room temperature for 1 h. After that membranes were incubated with 3 ml of ECL Western Blotting Substrate for 5 min in darkness at room temperature and developed the bands.

Fluorescence in situ hybridization assay

As previously described [33], the FISH probes for NEAT1.1 labelled with R-Phycoerythrin (excitation wavelength 565 nm), for miR-3122 labelled with FITC (excitation wavelength 495 nm) were purchased from G&P Medical Enterprises (Beijing, China). Slides filled with T24 cells washed by PBS were hypotension treatment in 0.075 M KCl at 37° C for 25 min, fixed by pure ethanol for 10 min and dropped on the glass slide, then aged at 56° C for 60 min. The slides were washed by PBS twice and dehydrated with the 70%, 85% and 100% ethanol for 3 min in order, and naturally dried. 10 μl probes were added on and mounted immediately. Slides were next denatured 75° C for 5 min and 42° C for 16 h, then removed the cover glass and incubated in 2 × SSC for 5 min and 0.1% NP-40/2 × SSC for another 2 min at 46° C, followed by 70% ethanol at room temperature for 3 min and dried in dark. 15 μl DAPI were dropped and mounted again. After 10 min incubation in dark, the slides were observed under the fluorescence microscope with the appropriate filters.

Statistical analysis

All experimental data were processed and analyzed using SPSS 22.0 statistical software. The measurement data were expressed as mean ± standard deviation. One-way ANOVA was used for comparison between multiple groups. The p-value less than 0.05 was considered as statistical significance.