Cardiac senescence is alleviated by the natural flavone acacetin via enhancing mitophagy

Acacetin improves heart function of D-galactose-induced accelerated aging mice

Subcutaneous injection of D-galactose (150 mg/kg) resulted in back hair loss was in 50% of aging C57/BL6 mice (6 of 12 mice), but not in mice with oral acacetin administration at 10, 20 or 50 mg/kg/day (Figure 1A, Supplementary Figure 1). Serum advanced glycation end products (AGEs) was increased in D-galactose-induced accelerated aging mice to 0.91 ± 0.17 μg/mL from 0.52 ± 0.13 μg/mL in control (n = 8, P < 0.05), which was decreased to 0.68 ± 0.12 μg /mL, 0.61 ± 0.11 μg/mL, and 0.51 ± 0.18 μg/mL in mice treated with 10, 20 or 50 mg/kg/day of acacetin, respectively (n = 7. P < 0.05 vs. D-galactose alone). These results suggest that acacetin may prevent D-galactose-induced hair loss and reduce the formation of AGEs.

Heart function of the experimental animals was evaluated using echocardiography (Figure 1B). The heart ejection fraction (EF) and the fractional shortening (FS) were decreased from 65.1 ± 2.5% and 35.1 ± 1.8% in control mice (n = 12) to 43.4 ± 3.1% and 21.3 ± 2.1% (n = 10, P < 0.01 vs. control) in aging mice induced by D-galactose with decreased thickness of the left ventricular anterior and posterior wall and increased systolic left ventricular inner diameter (Figure 1C). Intriguingly, the reduced EF and FS were countered in mice treated with oral acacetin administration in a dose-dependent manner, and the decreased thickness of diastolic left ventricular anterior wall thickness (LVAWd) and diastolic left ventricular posterior wall thickness (LVPWd) as well as the increased left ventricular end-systolic inner diameter (LVESD) were reversed by acacetin administration. In addition, heart weight (HW)/body weight (BW) ratio was significantly decreased with reduced thickness of left ventricular wall in D-galactose aging mice, which were improved in the aging mice treated with acacetin in a dose-dependent manner (Supplementary Figure 2). These results suggest that the reduction of heart function is likely resulted from a dilated cardiomyopathy in aging mice induced by D-galactose, and acacetin improves the heart function in a dose-dependent manner.

Acacetin decreases myocardial senescence markers and increases autophagy proteins in aging mouse model induced by D-galactose

Cardiac senescence is characterized by telomere length shortening [22, 23] and an increase in aging markers p53 and p21 with decreased autophagy in aging animals [20, 24]. We therefore determined the telomere length with qPCR (Supplementary Figure 3) using procedures described previously [25], and the protein levels of the senescence markers p53 and p21 with western blot analysis in myocardial tissues of C57/BL6 mice treated with D-galactose or D-galactose plus acacetin (Figure 2) to determine whether acacetin-induced improvement of the impaired heart function was related to inhibiting cardiac senescence. It is interesting to note that telomere length was shortened (Figure 2A), and p53 (Figure 2B) and p21 (Figure 2C) were significantly increased in mice treated with D-galactose, these effects were reversed in D-galactose mice treated with acacetin. In addition, the mitophagy core machinery kinases PINK1 and Parkin were downregulated in mice treated with D-galactose, and the decreased PINK1 and Parkin were upregulated in D-galactose mice treated with acacetin in a dose-dependent manner (Figure 2D, 2E). Moreover, myocardial Sirt6 expression was reduced in mice with D-galactose, which was also recovered in mice treated with acacetin. These results suggest that cardiac senescence induced by D-galactose can be countered by acacetin.

Effects of acacetin on cardiac senescence induced by D-galactose

To investigate the potential molecular mechanism involved in acacetin-mitigation on reduced cardiac function observed in D-galactose-induced aging mice, H9C2 cardiac cells were exposed to D-galactose (20 mg/mL) for 72 h in the absence or presence of acacetin (0.3, 1 or 3 μM). Figure 3 illustrates the effects of acacetin on D-galactose-induced cardiac senescence determined by senescence-associated-β-galactosidase (SA-β-gal) staining and flow cytometry with fluorescein di-β-D-galactopyranoside staining and western blot analysis for protein expression of the aging markers p53 and p21. The percentage of SA-β-gal positive (senescence) cells was increased by D-galactose from 7.4 ± 1.2% of control to 44.4 ± 1.9% which was reduced by acacetin treatment in a concentration-dependent manner (to 14.6 ± 1.8% at 3 μM acacetin) (Figure 3C). Flow cytometry analysis revealed that activity of β-galactosidase was greatly increased by D-galactose and decreased by acacetin (Figure 3C, 3D). The aging marker proteins p53 and p21 were upregulated by D-galactose, these upregulations were inhibited by acacetin treatment in a concentration-dependent manner (Figure 3E, 3F). These results demonstrate that D-galactose-induced senescence in H9C2 cardiac cells is mitigated by acacetin.

Acacetin reverses the decrease in cardiac mitophagy by D-galactose

Cell autophagy and mitophagy play a vital role in regulating cardiac senescence [26], we therefore determined the effects of acacetin on the cytosolic autophagosome marker kinases LC3I and LC3II, and the mitophagy kinases PINK1 and Parkin in mitochondrial proteins of H9C2 cardiac cells treated with D-galactose. D-galactose remarkably decreased the ratio of LC3II/LC3I (Figure 4A), and the mitophagy marker kinases PINK1 (Figure 4B) and Parkin (Figure 4C). Acacetin upregulated LC3II/LC3I ratio, PINK1 and Parkin in a concentration-dependent manner. Flow cytometry analysis revealed that aging cardiac cells induced by D-galactose showed a depolarized mitochondrial membrane potential (Figure 4D), which was reversed by acacetin in a concentration-dependent manner (Figure 4E). These results suggest that acacetin-induced improvement of cardiac senescence may be related to maintenance of integral mitochondrial function by enhancing mitophagy.

If the improvement of cardiac senescence induced by acacetin is due to enhancing mitophagy, the effect would be decreased by the autophagy inhibitor 3-methyladenine. Figure 5 illustrates the effects of acacetin on cardiac senescence induced by D-galactose in the absence and presence of 10 μM 3-methyladenine in H9C2 cardiac cells. Senescent cells were stained by SA-β-gal. 3-Methyladenine exacerbated cellular senescence, and abolished the acacetin-induced decrease of cardiac cell senescence (Figure 5A, 5B) and senescence marker proteins (Figure 5C, 5D). These results indicate that the anti-senescence effect of acacetin is related to promoting cardiac mitophagy.

Acacetin protects against cardiac senescence induced by activating Sirt6

Sirt6 plays an important role regulating aging and aging-related disorders [27]. This is supported by the observation in the present study, in which myocardial Sirt6 was downregulated in mice with D-galactose and was upregulated by acacetin treatment (Figure 2F). We therefore determined how Sirt6 is involved in acacetin protection against cardiac senescence in H9C2 cardiac cells (Figure 6). Acacetin enhanced Sirt6 expression in H9C2 cardiac cells (Figure 6A), and reversed D-galactose-induced Sirt6 reduction (Figure 6B) in a concentration-dependent manner. However, this was not observed in cells transfected with Sirt6 siRNA (Figure 6C). Acacetin also reversed D-galactose-induced reduction of pLKB1 (Figure 6D) and pAMPK (Figure 6E), and the effect was abolished in cells with silenced Sirt6 (Figure 6F). Moreover, silencing Sirt6 not only decreased mitophagy-associated proteins PINK, Parkin and LC3II/LC3I ratio, but also abolished acacetin-induced enhancement of these proteins (Figure 6G–6I). These results indicate that Sirt6 plays a crucial role in mediating the protection of acacetin against cardiac senescence by enhancing mitophagy.

Furthermore, cardiac senescence induced by D-galactose could be reduced by acacetin in H9C2 cardiac cells transfected with control siRNA, but not in cells transfected with Sirt6 siRNA (Figure 7A, 7B). The cardiac senescence markers p53 and p21 were reduced by acacetin in cells transfected with control siRNA, but not in cells with silenced Sirt6 (Figure 7C, 7D). These results indicate that Sirt6 plays a crucial role in mediating the protection of acacetin against cardiac senescence by enhancing mitophagy.

Sirt6 is a histone deacetylase that plays an essential role in regulating mitochondrial function in different cell types by deacetylation. The acetylated histone H3 lysine 9 (H3K9ac), which is correlated with transcriptional activation and chromatin reassembly during DNA replication, is a typical physiological substrate of Sirt6 [28]. We therefore determined the expression of H3K9ac in H9C2 cardiac cells with D-galactose- induced senescence with or without acacetin administration. H3K9ac was significantly increased in D-galactose-induced senescent cells, and acacetin (1–3 μM) reduced the increase of H3K9ac in a concentration dependent manner (Figure 7E). In another set of experiment with normal cell culture, H3K9ac was reduced by 3 μM acacetin in cells transfected with control siRNA; while H3K9ac was remarkably increased, and acacetin-induced reduction was abolished in cells transfected with Sirt6 siRNA (Figure 7F). These results suggest that the anti-senescence effect of acacetin correlates to the inhibition of histone acetylation through Sirt6 activation.

Our recent studies have shown that acacetin protects cardiac cells against doxorubicin-induced injury and endothelial cells against high glucose injury by activating Sirt1 followed by increasing pAMPK and/or Sirt3 [19, 29]. To determine whether beneficial effects of acacetin are mediated by other sirtuins, we determined the effects of acacetin on Sirt2, Sirt5, Sirt7, and also Sirt1 expression in H9C2 cardiac cells. Acacetin significantly increased Sirt1 expression, but did not increase Sirt2, Sirt5, or Sirt7 expression (Supplementary Figure 4).

Sirt1 is also involved in acacetin protection against D-galactose-induced senescence, and Sirt1 was downregulated in cardiac tissue of mice with D-galactose and acacetin administration reversed the reduced Sirt1 expression by acacetin in a dose-dependent manner (Supplementary Figure 5). The relation of Sirt6 to Sirt1 was determined in H9C2 cardiac cells transfected with Sirt6 siRNA or Sirt1 siRNA (Figure 8A–8D). It is interesting to note that silencing Sirt6 only reduced Sirt6 expression and abolished acacetin-induced increase of Sirt6, but had no effects on Sirt1 expression or acacetin-induced increase of Sirt1 (Figure 8A, 8B). However, silencing Sirt1 reduced both Sirt1 and Sirt6 expression and abolished acacetin-induced increase of Sirt1 and Sirt6 (Figure 8C, 8D). These results indicate that acacetin-induced Sirt6 increase is mediated by Sirt1 activation.

It is generally believed that mammalian sirtuins are regulated by the ratio of NAD⁺/NADH as well as activity of nicotinamide phosphoribosyltransferase (NAMPT) [30, 31]. We observed that NAMPT was reduced in cardiac tissue of mice with D-galactose and the reduction was reversed in mice with acacetin administration in a dose-dependent manner (Supplementary Figure 6). In addition, acacetin-induced Sirt1 and Sirt6 activations were found to be related to increase in NAD⁺/NADH ratio in H9C2 cardiac cells. Acacetin (3 μM) significantly increased NAD⁺/NADH ratio, while the NAMPT inhibitor GNE-617 (50 nM) [32] not only decreased NAD⁺/NADH ratio, but also abolished the effect of acacetin (Figure 8E). In addition, GNE-617 decreased both Sirt1 and Sirt6 protein level, and fully abolished acacetin-induced increase of Sirt1 and Sirt6 expressions (Figure 8F, 8G). These results indicate that activation of Sirt1 and Sirt6 is related to increasing NAD⁺/NADH ratio in H9C2 cardiac cells.

Reagents and antibodies

Acacetin (5,7-dihydroxy-4’-methoxyflavone) used in the present study was synthesized in the laboratory as described previously [40]. Dulbecco’s modified Eagle’s medium (DMEM), Lipofectamine RNAiMAX Reagent and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltham, MA, USA), and senescence-associated β-galactosidase (SA-β-gal) staining Kit and Fluorescein di-β-D-galactopyranoside (FDG) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Small-interfering RNAs for Sirt6 and Sirt1were from GenePharma (Shanghai, China). The autophagy inhibitor 3-methyladenine (3-MA) was purchased from MedChemExpress (Shanghai, China). Antibodies used in the present study are listed in Supplementary Table 1.

Animal experiments

Male C57BL/6 mice (8–10 week-old) were purchased from Wu Experimental Animal Trading Co, Ltd (Fuzhou, China) and maintained under regular light/dark cycle and free access to water and chow diet. The experimental protocol was approved by Animal Use Ethics Committee for Teaching and Research of Xiamen University following the Guidelines on the Use and Care of Laboratory Animals for Biomedical Research published by National Institutes of Health (No. 85–23, revised 1996).

The aging model [20, 21] was induced in C57BL/6 mice by subcutaneous injection of D-galactose (150 mg/kg/day, Sigma Aldrich) or saline (control) for 10 weeks. For drug treatment groups, the D-galactose animals received 10, 20, and 50 mg/kg acacetin daily by intragastric administration, while equivolume vehicle was used for control animals and D-galactose model animals. Echocardiography was performed at end of the experiment, and the animal hearts were dissected, frozen and stored at −80ºC for molecular analysis.

Echocardiography

Heart function was determined using a Vevo 2100 echocardiograph (VisualSonics Inc., Toronto, Ontario, Canada) in mice anesthetized with 1.5–2.0% isoflurane. Cardiac function and structure were measured with M-mode echocardiography as described previously [19].

Determination of serum advanced glycation end products (AGEs)

The serum AGEs were determined in each group by enzyme-linked immunosorbent assay using commercial kits (No. CSB-E09414m, Huamei Biotechnology Co. Ltd., Wuhan, Hubei, China) following manufacturer's instructions. In brief, standard or sample was added to each well and incubated 2 hours at 37°C. Then the liquid was removed without washing, Biotin-antibody (1×) was added to each well. After washing for 3 times, avidin horseradish peroxidase (1×) was added to each well for 1 h at 37°C. Then 3,3′,5,5′-tetramethylbenzidine substrate was added for 30 min at 37°C. Finally, stop solution was added to terminate reaction. The plate was read at 450 nm within 5 min, and AGEs level was then calculated.

Heart section hematoxylin-eosin staining

After reperfusion with normal saline, the isolated mouse heart was weighed, embedded in the optimal cutting temperature compound medium (Sakura Finetek, Japan), then frozen in liquid nitrogen for a few seconds and stored in -80° refrigerator. The heart was sectioned into 6-μm thick slices with a freezing microtome (CM1950, Leica, China). The heart slices were fixed in 4% paraformaldehyde at room temperature for 10 min, washed with running water for 2 min, and stained with hematoxylin-eosin (HE) staining kit (Solarbio, Beijing, China) following the manufacturer’s instructions. The section images were taken with TissueFAXS Plus S (Tissue Gnostics, Austria).

Cell culture

H9C2 rat cardiomyocyte cell line (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS and 1% v/v penicillin/streptomycin at 37°C in 5% CO₂. When grew to ~80% confluence, the cells were exposed to D-galactose (20 mg/mL) or D-galactose plus acacetin (0.3, 1 or 3 μM) or equivolume vehicle for 72 h. When the siRNA molecules were transfected, cells were treated with Lipofectamine RNAiMAX reagent plus siRNA molecules for 8 h, then exposed to D-galactose in the absence or presence of acacetin for 48–72 h. In the experiments with the NAMPT inhibitor GNE-617 (50 nM) [32] H9C2 cardiac cells were incubated with or without this inhibitor in the absence or presence of 3 μM acacetin for 24 h to inhibit NAD⁺ production.

Western blot analysis

Western blot analysis was employed to determine specific protein expression with the procedure as described previously [17, 18]. Briefly, total protein was extracted from mouse myocardial tissues, H9C2 cardiac cells or H9C2 cell mitochondria using RIPA lysis buffer with protease inhibitor cocktail (Beyotime, Shanghai, China). Protein concentration was determined using a Bicinchoninic Acid Protein Assay Kit (Solarbio, Beijing, China). The proteins samples were separated through SDS-PAGE and transferred to a polyvinylidene fluoride membrane (Bio-Rad, Hercules, CA, USA). Afterwards, the membranes were blocked with 5% non-fat milk at room temperature for 1 h and incubated with specific primary antibodies as described in Supplementary Table 1 at 4ºC overnight. Membranes were washed three times (10 min each wash) with TBST. The membranes were then incubated with secondary antibodies. After the last wash, the relative expression levels of the proteins were detected using an Enhanced Chemiluminescent detection system. All western blots were repeated at least four experiments, and the signal intensity of the immunoreactive bands was quantified using Image J software (NIH, Bethesda, MD, USA).

SA-β-gal staining

To estimate cell senescence, senescence-associated β-galactosidase (SA-β-gal) staining was performed following the manufacturer’s instructions. Briefly, H9C2 cardiac cells were seeded in a 6-well plate and grew to ~80% confluence. The cells were treated with D-galactose (20 mg/mL), D-galactose plus acacetin (0.3, 1 or 3 μM) or equivolume vehicle for 72 h. The cells were washed with phosphate buffered saline (PBS) and fixed with fixative solution for 15 min at room temperature. After 3 washes with PBS, the cells were incubated with β-galactosidase staining solution overnight in a dry incubator. Then the cells were observed and images were taken with a light microscope. The percentage of positive cells was calculated by counting the blue-stained cells and total cells (as a standard) in five randomized fields.

Flow cytometry analysis

Flow cytometry analysis was employed with a flow cytometer (Beckman Coulter, USA) to determine mitochondrial membrane potential and β-galactosidase activity level as described previously [69]. To measure the mitochondrial membrane potential, a JC-1 Mitochondrial Membrane Potential Assay Kit (Solarbio, Beijing, China) was used following the manufacturer’s instructions. Briefly, H9C2 cardiac cells were seeded in a 6-well plate and grew to ~80% confluence. The cells were treated with D-galactose (20 mg/mL), D-galactose plus acacetin (0.3, 1 or 3 μM) or equivolume vehicle for 72 h, and then were incubated with DMEM containing JC-1 (2 μM), a membrane permeable dye for probing mitochondrial membrane potential (Solarbio, Beijing, China), at 37°C for 20 min. Green fluorescence reflected the monomeric form of JC-1, and red fluorescence reflected the aggregate form. Mitochondrial membrane potential was then analyzed with a flow cytometer.

For β-galactosidase activity determination, H9C2 cardiac cells were cultured in the absence and presence of acacetin. After D-galactose exposure, the cells were incubated with 33 μM fluorescein di-β-D-galactopyranoside (FDG) (Sigma-Aldrich) at 37°C for 30 min and intracellular β-galactosidase activity was determined by a flow cytometer.

Quantitative PCR measurement of telomere length

Telomere length was determined in the cardiac tissue following the procedure as described previously [25]. Briefly DNA was extracted from cardiac tissues using the MiniBEST Universal Genomic DNA Extraction Kit (Takara, Dalian, China), and the telomere length was analyzed using quantitative PCR (qPCR). The sequences (5′−3′) of primers were: Forward−GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT, Reverse− TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA for telomere; Forward−CACACTCCATCATCAATGGGTACAA, Reverse− CAGTAAGTGGGAAGGTGTACTCA for 36B4. Thermocycling parameters were 95°C for 10 min followed by 40 cycles of 95°C for 15s and 54°C for 60s. All samples were analyzed in triplicate using ABI 7900HT thermal cycler (Applied Biosystems). The relative telomere length was normalized to the internal control 36B4 rRNA.

Mitochondrial protein extraction

Mitochondria was isolated from H9C2 cardiac cells using a Mitochondria Extraction Kit (Solarbio, Beijing, China) following the manufacturer’s instructions. Briefly, H9C2 cardiac cells were cultured with D-galactose (20 mg/mL) or D-galactose plus acacetin (0.3, 1 or 3 μM) or equivolume vehicle for 72 h. Then, the cells were sonicated and centrifuged to separate cytoplasmic and mitochondrial fractions. The mitochondrial fraction was collected for extracting mitochondrial protein using a RIPA lysis buffer.

NAD⁺/NADH determination

H9C2 cardiac cells were cultured with or without the NAMPT inhibitor GNE-617 (50 nM) [32] in the absence or presence of 3 μM acacetin for 24 h. Then the cells were harvested and washed with PBS and centrifuged 4 × 1000 rpm for 10 min. The oxidized nicotinamide adenine dinucleotide NAD⁺ and NADH (a reduced form of nicotinamide adenine dinucleotide) levels were quantified using an EnzyChrom™ NAD⁺/NADH assay kit (Bioassay Systems, Hayward, CA, USA) following the manufacturer’s instructions.

Statistical analysis

Data were expressed as mean ± SEM and analyzed using GraphPad Prism 5.0 software. Multiple group data were statistically analyzed by one way ANOVA followed by Tukey’s post hoc test. A P value <0.05 was considered as statistically significant difference.