PTPN2 negatively regulates macrophage inflammation in atherosclerosis

PTPN2 is negatively correlated with inflammation in ApoE^-/- mice

In order to investigate the pathogenesis of atherosclerosis, we constructed an APOE^-/- mice model of atherosclerosis. The photomicrograph of atherosclerotic lesions stained with Hematoxylin-Eosin was showed in Figure 1A. Due to the release of inflammatory factors is one of its typical characteristics, we detected the expression of IL-6, IL-12 and IL-1β in normal and inflammatory aortic roots of ApoE^-/- mice. qRT-PCR assay showed that the mRNA levels of inflammatory factors IL-6, IL-12 and IL-1β were significantly increased in inflammatory APOE^-/- mice (Figure 1B). Consistently, the protein concentrations of IL-6, IL-12 and IL-1β were also significantly increased in inflammatory APOE^-/- mice (Figure 1C). PTPN2, which is one of non-receptor protein tyrosine phosphatases, is related to the occurrence of various inflammatory-linked diseases [25, 26]. In order to explore the relationship between PTPN2 and inflammation in APOE^-/- mice, we detected the expression of PTPN2 in normal and inflammatory APOE^-/- mice. qRT-PCR assay showed that the mRNA expression of PTPN2 was significantly reduced in inflammatory APOE^-/- mice (Figure 1D). Consistently, the protein level of PTPN2 in three different inflammatory APOE^-/- mice was also lower than that in normal control mice (Figure 1E). In addition, we also analyzed the protein level of PTPN2 in normal and inflammatory APOE^-/- mice by confocal microscopy. Compared with the normal control, PTPN2 in inflammatory APOE^-/- mice was significantly reduced, while the expression level of CD11b has no obvious change (Figure 1F). These results indicate that the APOE^-/- mice model of atherosclerosis has obvious inflammation, and PTPN2 is negatively correlated with inflammation in ApoE^-/- mice.

PTPN2 deficiency enhances the secretion of inflammatory cytokines in THP-1 cells and U937 cells, and toward M1 phenotype

In order to reveal the function of PTPN2 in the occurrence of atherosclerosis, we artificially synthesized two shRNA of PTPN2 gene, and used the THP-1 cell and U937 cell as the model to research. Firstly, we transfected these two shRNA segments into THP-1 cell and U937 cell, and analyzed the protein of PTPN2 by Western blot assay. Results showed that both shRNA could significantly inhibit the expression of PTPN2 protein (Figure 2A). To explore the effect of PTPN2 deficiency on the secretion of inflammatory factors, we examined the changes of IL-12 and IL-1β in THP-1cells and U937 cells. qRT-PCR assay showed that PTPN2 deficiency could enhance the mRNA expression of IL-12 and IL-1β (Figure 2B). Conversely, overexpression of PTPN2 could also significantly inhibit the expression of IL-12 and IL-1β in THP-1 cells and U937 cells (Figure 2C). In addition, the activation of NF-κB signal pathway, MAPK signal pathway and JAK-STAT signal pathway are closely related to the secretion of inflammatory factors [27–29]. We also tested the phosphorylation levels of p65, p38 and STAT3 in THP-1 cells and U937 cells. Western blot experiments showed that shRNA-1 or shRNA-2 of PTPN2 could increase the phosphorylation levels of p65, p38 and STAT3, but it has no obvious change on total p65, p38 and STAT3 proteins (Figure 2D). These results indicate that PTPN2 deficiency induces the secretion of inflammatory factors by activating the p65/p38 /STAT3 signal pathway.

In addition, we also analyzed the polarization characteristics of THP-1 cells and U937 cells. As shown in Figure 2E, the expression of IL-6, TNF-a, and iNOS, which associated with M1 polarization, were significantly increased in PTPN2 deficiency cells. Conversely, the expression of Arginase1, Ym1, and IL-10, which associated with M2 polarization, were reduced in PTPN2 deficiency cells (Figure 2F). F4/80⁺ CD11C⁺ is the surface antigen marker of M1 phenotype, while CD206⁺ / CD11B⁺ is the surface antigen marker of M2 phenotype. Flow cytometry assays showed that THP-1 cell with F4/80⁺CD11C⁺ were significantly increased, and THP-1 cell with CD206⁺ / CD11B⁺ were significantly decreased after PTPN2 was suppressed by its shRNA (Figure 2G). The results observed in U937 cells were consistent with those results in THP-1 cells (Figure 2H). All of these results showed that the loss of PTPN2 will lead to enhance the secretion of inflammatory cytokines and toward M1 phenotype.

PTPN2 deficiency promotes the proliferation, migration and invasion of THP-1 cells and U937 cells

In order to further reveal the effect of PTPN2 deletion on THP-1 cells and U937 cells, we examined the cell proliferation ability with PTPN2 deficiency by EDU assay. Results showed that the proliferation ability of THP-1 cells and U937 cells with PTPN2 deficiency was enhanced when compared to control cells (Figure 3A). The proliferation and apoptotic capacity were also detected by clone formation assay and flow cytometry. Results showed that cells with PTPN2 deficiency has stronger proliferation ability than the control cells (Figure 3B). Flow cytometry assay showed that there was no difference in the proportion of apoptotic cells between PTPN2 deficiency cells and control cells (Figure 3C). In addition, we also incubated HUVEC cells with THP-1 cells or U937 cells for a period of time, and found that the proliferation ability of HUVEC cells was increased significantly (Figure 3D). These results showed that interference with the expression of PTPN2 gene could promote cell proliferation, with no effect on its apoptosis. In addition, we also evaluated the migration and invasion ability of THP-1 cells and U937 cells. Results showed that deletion of PTPN2 could enhance the migration and invasion of cells (Figure 3E, 3F). The above results suggested that PTPN2 deficiency promotes proliferation, metastasis and invasion of THP-1 cells and U937 cells.

PTPN2 inhibitor XIX mimics the effects of PTPN2 deletion in THP-1 cells

To further examine the function of PTPN2 in macrophages, we used several concentrations of XIX, a PTPN2 inhibitor, to treat with THP-1 cells. The expression of PTPN2 and the secretion of IL-12 and IL-1β were detected. Results showed that XIX with 0.25uM, 0.5uM, and 1.0uM could inhibit the expression of PTPN2 protein, and the effect of inhibition was more obvious when the concentration of XIX increased (Figure 4A). Furthermore, we combined XIX (1.0 μM) and ox-LDL to treat with THP-1 cells and examined the secretion of IL-12 and IL-1β. Compared with the group which only treated with ox-LDL, the mRNA of IL-12 and IL-1β were increased in the XIX + ox-LDL group (Figure 4B). Consistently, the secretion of IL-12 and IL-1β were also enhanced in the XIX + ox-LDL group (Figure 4C). In addition, we detected the phosphorylation levels of p65, p38, and STAT3 proteins in different groups. Results showed that the levels of p-p65, p-p38, and p-STAT3 proteins were higher in XIX + ox-LDL group than in ox-LDL group (Figure 4D). We also examined the effect of XIX on the migration, invasion, and proliferation ability of THP-1 cells. Compared with the group which treated with ox-LDL alone, the metastatic and invasion capacity of cells in the XIX + ox-LDL group were enhanced (Figure 4E, 4F). MTT assay showed that the proliferation ability of cells was enhanced in the XIX + ox-LDL group (Figure 4G). These results showed that, similar to the shRNA of PTPN2, XIX combined with ox-LDL could also induce the phosphorylation of p65, p38 and STAT3, enhance the secretion of IL-12 and IL-1β, and promote cell proliferation, invasion and metastasis.

PTPN2 can be a potential treatment target of atherosclerosis

To explore the potential application value of PTPN2 on the treatment of atherosclerosis, we performed an in vivo assay in APOE^-/- mice. PBS control or PTPN2 antibody were injected into APOE^-/- mice by tail vein injection. Expression of PTPN2 proteins were detected by immunohistochemistry assay. The mRNA and protein levels of IL-6, IL-12 and IL-1β were analyzed by qRT-PCR assay and ELISA assay. Immunohistochemistry assay showed that PTPN2 antibody could reduce the expression of PTPN2 in macrophages of mice (Figure 5A). The mRNA and protein levels of IL-6, IL-12 and IL-1β was increased in macrophages when treated with PTPN2 antibody (Figure 5B, 5C). The phosphorylation levels of p65, p38, and STAT3 protein were also elevated after treatment with PTPN2 antibody (Figure 5D). Further research revealed that the ability of metastasis and invasion were enhanced when treatment with PTPN2 antibody (Figure 5E, 5F). MTT experiments showed that PTPN2 antibody could significantly promote the proliferation of macrophages (Figure 5G). These results indicated that PTPN2 plays a negative role in the occurrence of atherosclerosis by inhibiting the secretion of inflammatory cytokines, and may be a potential treatment target of atherosclerosis.

Atherosclerosis model in mice

All of animal assays in this study were carried out and approved by Animal Care Committee of Jiangxi Provincial People's Hospital Affiliated to Nanchang University according to the guidelines. ApoE^-/- mice (6-week old male) were fed with high-fat diet (HFD) and induced to be atherosclerosis mice model. 12 weeks later, all ApoE^-/- mice were killed by cervical dislocation, and the aortic roots were isolated and frozen in liquid nitrogen for subsequent experiments. PTPN2 antibody were intravenously injected through tail vein of ApoE^-/- mice. Macrophages in aortic roots were isolated by use of tissue lymphocyte separation solution (TBD, Tianjin, China) according to the protocol, and cultured in DMEM medium (Invitrogen, USA) with 1% penicillin/streptomycin (Sigma-Aldrich, USA), used in following experiments.

Cell culture

THP-1 cells were purchased from the ATCC (Manassas, USA). RPMI1640 culture medium (Invitrogen, USA) was used for the culture of this cells. 10% heat-inactivated FBS (Invitrogen, USA) and 1% penicillin/streptomycin (Sigma, USA) were added in the medium. These cells were incubated in a humidified atmosphere of 5% CO2 at 37° C. PTP inhibitor XIX is purchased from Sigma Aldrich. The Lot No. of PTP inhibitor XIX is 540215.

Enzyme-linked immunosorbent assay (ELISA)

The protein expression of IL-6, IL-12 and IL-1β were detected by ELISA kits (R&D Systems, Minneapolis, MN, USA) following the manufacturer's protocols.

RNA isolation and qRT-PCR assay

Total RNA was extracted using the RNAiso Plus and reversely transcribed into cDNA using the Prime Script RT Master Mix. SYBR Premix Ex Taq II (Takara Bio, China) was used for qPCR assay. The primers used in human cells are as follows:

PTPN2-Forward (5'-3'): CATGCTGAACCGCATTGTGGAG,

PTPN2-Reverse (5'-3'): GACAAGAGCTTCACACTGAATCC;

IL-6-Forward (5'-3'): AGACAGCCACTCACCTCTTCAG,

IL-6-Reverse (5'-3'): TTCTGCCAGTGCCTCTTTGCTG;

IL-12-Forward (5'-3'): TGCCTTCACCACTCCCAAAACC,

IL-12-Reverse (5'-3'): CAATCTCTTCAGAAGTGCAAGGG;

IL-1β-Forward (5'-3'): CCACAGACCTTCCAGGAGAATG,

IL-1β-Reverse (5'-3'): GTGCAGTTCAGTGATCGTACAGG;

iNOS-Forward (5'-3'): GCTCTACACCTCCAATGTGACC,

iNOS-Reverse (5'-3'): CTGCCGAGATTTGAGCCTCATG;

TNF-α-Forward (5'-3'): CTCTTCTGCCTGCTGCACTTTG,

TNF-α-Reverse (5'-3'): ATGGGCTACAGGCTTGTCACTC;

Arginase-1-Forward (5'-3'): TCATCTGGGTGGATGCTCACAC,

Arginase-1-Reverse (5'-3'): GAGAATCCTGGCACATCGGGAA;

Ym-1-Forward (5'-3'): TACTCACTTCCACAGGAGCAGG,

Ym-1- Reverse (5'-3'): CTCCAGTGTAGCCATCCTTAGG;

IL-10-Forward (5'-3'): TCTCCGAGATGCCTTCAGCAGA,

IL-10-Reverse (5'-3'): TCAGACAAGGCTTGGCAACCCA;

GAPDH-Forward (5'-3'): GTCTCCTCTGACTTCAACAGCG,

GAPDH-Reverse (5'-3'): ACCACCCTGTTGCTGTAGCCAA.

The primers used in mouse cells are as follows:

IL-12-Forward (5'-3'): ACGAGAGTTGCCTGGCTACTAG,

IL-12-Reverse (5'-3'): CCTCATAGATGCTACCAAGGCAC;

IL-6-Forward (5'-3'): TACCACTTCACAAGTCGGAGGC,

IL-6-Reverse (5'-3'): CTGCAAGTGCATCATCGTTGTTC;

IL-1β-Forward (5'-3'): TGGACCTTCCAGGATGAGGACA,

IL-1β-Reverse (5'-3'): GTTCATCTCGGAGCCTGTAGTG;

GAPDH-Forward (5'-3'): CATCACTGCCACCCAGAAGACTG,

GAPDH-Reverse (5'-3'): ATGCCAGTGAGCTTCCCGTTCAG.

The Applied Biosystems 7900 Real Time PCR System (Applied Biosystems, USA) was used according to the manufacturer's instruction. CT values were recorded and expression of genes was calculated using the equation 2^-ΔΔCt.

Transfection of shRNA

Scrambled shRNA control and PTPN2-shRNA were transfected into THP-1 cells using Lipofectamine 2000 (Thermo Fisher) in 24-well plates. THP-1 cells were incubated for 18 h with in Opti-MEM containing 3μL Lipofectamine 2000 per 2×105 cells and 20-50 nM shRNA according to the instructions. The sequence of shRNA are as follows:

shRNA-1-F: GTGTGAAGCTCTTATCTGA,

shRNA-1-R: TCAGATAAGAG CTTCACAC;

shRNA-2-F: GCTCTTATCTGAAGATGTA,

shRNA-2-R: TACATCTTCAGATAAGAGC.

Western blot analysis

Total proteins were extracted with SDS lysis buffer, and then separated by 10% SDS polyacrylamide gels. Proteins were transferred to the PVDF membrane after electrophoresis and blocked with 5% defatted milk for 1 hour. The blots were incubated with primary antibodies overnight, and then incubated with goat-anti-mouse IgG or goat-anti-rabbit IgG. β-actin or GAPDH was used as a loading control. The primary antibodies: anti-p38(1:1000, Abcam), anti-p-p38 (1:1000, Cell Signaling Technology), anti-p65 (1:1000, Cell Signaling Technology), anti-p-p65 (1:1000, Cell Signaling Technology), anti-STAT3 (1:1000, Cell Signaling Technology), anti-p-STAT3 (1:1000, Abcam), anti-PTPN2 (1:1000, Cell Signaling Technology), and anti-β-actin (1:5000, Cell Signaling Technology) were used in this study.

Confocal microscopy assay

Macrophages were isolated from the aortic roots of mice and were incubated with primary antibodies of PTPN2 and CD11b (CST, USA) and following secondary fluorescence-labelled antibodies (CST, USA). DAPI solution was applied to stain cell nucleus. Cells were scanned under the confocal laser scanning microscope.

EDU assay

EDU assay (Beyotime, Nanjing, China) was carried out to determine macrophages proliferation. 1x10⁴ cells were incubated in a 96-well plate overnight and then transfected by shRNA-1 or shRNA-2. The cell viability was detected after adding EDU solution to each well and incubating. Immunofluorescence analysis was performed for EDU detection.

Cell proliferation, migration and invasion assay

MTT assay was performed to analyze the proliferation ability of cells. 2×10⁵ cells were plated in 24-well plates and cultured for 3 days. Cell viability was evaluated by the absorbance of 490nm (OD490) according to the instructions. 500 cells were plated in 6-well plates and cultured for 10-14 days in colony formation assay. Cell viability was evaluated by the count of colonies. 2×10⁵ cells were seeded into the chamber (migration) or matrigel coated chambers (invasion) and incubated 24h or 36h. The migration and invasion cells were evaluated by the count of five randomly selected optical fields.

Flow cytometry assay

The THP-1 cells which transfected with shRNA-1 or shRNA-2 of PTPN were harvested, and the Annexin V-APC kit (eBioscience, USA) was performed to evaluate the apoptosis of THP-1 cells. Antibodies against F4/80, CD11b, CD11c, CD206 and controls and secondary antibodies (eBioscience, USA) were incubated with cells according to the manufacturers’ instructions. All experiments were performed independently in triplicate.

Statistical analysis

Student's t-test was carried out to analyze the difference between groups, and it is statistical significance when P value was less than 0.05. At least three independent experiments were performed for data analysis. GraphPad Prism (Version5.0) were used for the statistical analysis.