PP2A subunit PPP2R2C is downregulated in the brains of Alzheimer’s transgenic mice

PPP2R2C regulates PP2A phosphatase activity

First, we investigated whether PPP2R2C is essential for PP2A activity. We measured phosphatase activity combined with immunoprecipitation of PP2A in SHSY5Y human neuroblastoma cell lines. After knocking down PPP2R2C expression, we observed decreased PP2A phosphatase activity, while overexpression of wildtype PPP2R2C increased PP2A phosphatase activity (Figure 1A).

We further addressed the mechanism through which PPP2R2C regulates PP2A activity. The activity of PP2A is regulated by several post-translational modifications, including phosphorylation of Tyr or Thr, which inactivates PP2A, and methylation of the carboxyl-terminal leucine, Leu309, which activates PP2A. Interestingly, downregulation of PPP2R2C led to increased phosphorylation of the PP2A catalytic (PP2AC) domain at Tyr 307, while overexpression of PPP2R2C had the opposite effect (Figure 1B and 1C). This finding indicates that PPP2R2C regulates PP2A activity through phosphorylation of the PP2AC subunit.

PPP2R2C expression decreases in the brains of AD mice

Next, we measured the expression pattern of PPP2R2C mRNA in the mouse brain (cortex and cerebellum), heart, liver, intestine, muscle, lung, skin and ovary at different ages. As expected, in young (3 months) and old (12 months) mice, the relative expression of PPP2R2C mRNA was much higher in the two brain tissues than in the other organs tested (Figure 2A, Supplementary Figure 1). Then, we asked whether PPP2R2C is expressed in specific cell types of the brain. We detected PPP2R2C both in the nucleus and in the cytoplasm of neural stem cells, neurons and astrocytes isolated from the brain of newborn Wt mice (Figure 3). Together with the high level of PPP2R2C mRNA in both the cortex and cerebellum (Figure 2A), these results suggest that PPP2R2C is restricted neither to a particular cell population nor to a particular region of the brain.

Then, we investigated whether the expression level of PPP2R2C mRNA and protein in the cortex varies over the lifetimes of Wt and AD (B6C3-Tg (APP^Swe/PS1^dE9)) mice [14]. In both genotypes, the protein level of PPP2R2C is maximum at 9 months while the increase is much less marked in AD mice and remains lower than Wt over life time (Figure 2B). Interestingly, the PPP2R2C expression level does not differ between Wt and AD mice in young animals (3 months, Figure 2B) and becomes differentially regulated between 3 and 9 months, i.e. at the time where the AD symptoms appear [15]. The mRNA level of PPP2R2C is also reduced in AD mice as compared to age-matched Wt mice (Figure 2C). Notably, as compared to the protein expression level, there is a second peak of PPP2R2C mRNA expression later in life (16 months, Figure 2C), suggesting a differential post-transcriptional regulation of PPP2R2C in aging mice.

In summary, PPP2R2C expression is significantly downregulated after brain maturation in AD mice.

PPP2R2C is required for tau dephosphorylation

Finally, we asked whether PPP2R2C could contribute to tau dephosphorylation. Knockdown of PPP2R2C led to increased levels of phospho-tau at S396, S262 and T181 (Figure 4). Overexpression of PPP2R2C inhibited tau phosphorylation. Thus, PPP2R2C is required for tau dephosphorylation. This regulation of tau dephosphorylation by PPP2R2C is not dependent on the particular cell line used since it is also observed in 293T cells, a human renal epithelial cell line (Supplementary Figure 2A–2C).

Cell lines, media and reagents

293T cells and SHSY5Y cells (human neuroblastoma cell line) were obtained from cell resources center of Shanghai Life Research Institute. The cell were cultured in DMEM medium (Gibco, MA, USA) supplemented with 10% fetal calf serum (FBS) and 1% (v/v) penicillin-streptomycin (Sangon, China) at 37°C, 5%CO2 cell culture incubator. The cell culture media were changed every 3 days until the cells were confluent.

Lentiviral packing and transfection

To create the lentiviruses, 8.6 μg of pWPIR-GFP vector expressing empty vector, PPP2R2C; or pLKO.1 vector expressing PPP2R2C shRNA or non-coding shRNA, 8.6 μg of pCMVΔR8.91 and 2.8 μg of pCMV-VSV-g were introduced into 5×10⁶ 293T cells in DMEM, supplemented with 10% FBS at 37° in 5% CO2 in 10 cm dishes, through calcium phosphate mediated transfection (Promega E1200, USA). Virus containing supernatants were collected after 48 hours and 72 hours, passed through a 0.45 μm Millipore filter and used to infect target cells. The efficiency of infection was determined by flow cytometry analysis of GFP expression 3 days or puromycin selection 1 week after infection.

Lentivirus production and infection

Lentiviruses were produced by transient calcium phosphate transfection of 293T cells with the virus packaging plasmids, p8.91 and pVSVg, as well as with the lentiviral expression vector that contained the sequence of interest. Titration was performed approximately 10 days after infection by means of puromycin (1 μg/ml) selection of clones. The following shRNA plasmids were purchased from Sigma and used for lentivirus production: pLKO-shScramble, pLKO-shPPP2R2C. The construct containing full-length PPP2R2C was designed and performed in the pWPIR lentivirus vector system. Infection with various shRNAs or overexpression vectors was performed for a minimum of 4 days, and depending on experiment, cells were kept in culture for up to 10-15 days after infection. Efficiency of each shRNA was checked routinely by RT-qPCRs or western blotting.

Mice and tissue preparation

APP^Swe/PS1^dE9 (The Jackson Lab, No. 004462) Tg mice and their Wt littermates used in this study at the age of 3, 6, 9, 12, 16 and 18 months were bred by male heterozygote and female Wt mice. The maintenance, breeding and staging were performed in accordance with the Laboratory Animal Care Guidelines approved by the animal committee of Shanghai Jiaotong University School of Medicine. The mice were anesthetized and perfused with ice-cold 0.1M PBS, and then the cerebral cortex, cerebellum, heart, liver, muscle, lung, skin and ovary were dissected, and tissues were used to prepare RNA and/or protein.

Primary neural cell, media and reagents

Primary neural cell were isolated from newborn Wt mouse brains at 0-1 days old. The brain tissues were placed to cold PBS, then cerebral cortices and hippocampus were carefully dissociated. Cultures for neural stem cell were incubated in NeuroCult NSC basal medium with NSC Proliferation supplement, 20 ng/ml EGF, 20 ng/ml bFGF, 2ug/ml heparin and 1% Pen-Strep. Cultures for neuron were incubated in serum-free Neurobasal medium supplemented with B-27, L-glutamine and 1% Pen-Strep. Cultures for astrocytes (Glia) were incubated in DMEM and Ham’s nutrient mixture F-12 (1:1) medium supplemented with 10% FBS, 1xglutamax and 1% Pen-Strep. A single-cell suspensions was prepared by trypsinization or PDD (Papain, DNase I, Dispase) and washed with corresponding culture medium, then plated in 24 well plate at a density at 1*10^5 cells/ well. All the primary cells were maintained at 37°C in a 5% CO2 incubator and split every 3–5 days and then the cells were ready for subsequent study.

Immunofluorescence assay

Cells were grown onto glass cover slips and fixed for 10 min with 3% formaldehyde in PBS. Cells were then permeabilized with 0.5% Triton X-100 for 10 min and incubated for at least 2h at room temperature in blocking solution (0.5% Triton X-100 and 4%BSA in PBS). Cells were then stained overnight at 4°C in blocking solution containing the respective primary antibodies (PPP2R2C, 1:100, SantaCruz, sc100417; Nestin, 1:100, Abgent, AP2020; NeuN, 1:200, Millipore, ABN78; GFAP, 1:200, Abcam, ab53554). After 0.1% Triton X-100 in PBS washes, cells were incubated for 1 hour at 37°C with the corresponding secondary antibodies (Alexa Fluor, 1:400, Invitrogen) in blocking solution. Finally, cells were mounted with DAPI (Vectashield, Vector Laboratories). Images were obtained with a Leica SP8 confocal microscope.

Real-time RT-qPCRs

Total RNA was isolated from organs and cells using the Trizol reagent (Invitrogen, USA). The RNA pellet was dissolved in diethyl pyrocarbonate-treated H2O. First-strand cDNA synthesis was performed with 0.5 μg of total RNA using oligo(dT) primers and Superscript I reverse transcriptase (Takara, Japan) for mouse tissues. 1 μl of the reaction product was taken for real time RT-qPCRs amplification (ABI Prism 7000, Applied Biosystems) using a commercial SYBR® Green kit (Tiangen, China). Primer sequences were available on request. Expression of each gene was normalized to the respective beta-actin, and Rplp0 (36B4) expression.

Western blots

Cells and Mouse cortex were lysed with the ice cold lysis buffer containing 1xRIPA (Beyotime Biotechnology, China), 1mM Phenylmethylsulfonyl fluoride (PMSF, Beyotime Biotechnology), a protease inhibitor mixture (Roche Molecular Biochemical, Switzerland), and a phosphatase inhibitor cocktail (Roche Molecular Biochemical, Switzerland) for 5 min. The lysate was centrifuged at 12,000× g for 30 min at 4°C, and the supernatant fraction was used for western blot analysis. 30-50ug of protein samples were subjected to 10%SDS–polyacrylamide gel electrophoresis. The gels were transferred onto PVDF membranes (Millipore, USA). The membranes were incubated for 1h at room temperature in blocking solution (5% milk in TBS buffer containing 0.1% (v/v) Tween-20 (TBST)), and then were incubated overnight at 4°C in blocking solution containing the following antibodies: mouse monoclonal anti-PPP2R2C (1:500, Santa Cruz, sc100417), mouse monoclonal anti-PPP2R2C (1:1000, Abcam, ab58153), mouse monoclonal anti-GAPDH (1:2500, Aogma, 9600), rabbit polyclonal anti-Tau(1:2500, Abcam, ab64193), rabbit monoclonal anti-Tau phospho S396(1:10000, Abcam, ab109390), rabbit monoclonal anti-Tau phospho S262(1:2500, Abcam, ab92627), rabbit polyclonal anti-Tau phospho T181(1:2500, Novus bio, NB100-82245), rabbit monoclonal anti-PP2A(1:2500, epitomics, 1512-1), rabbit monoclonal anti-PP2A phospho Y307(1:2500, epitomics, 1155-1). For enhanced chemiluminescence (ECL) detection, HRP-conjugated rabbit antibody (1:2500, beyotime, A0208) and mouse antibody (1:2500, cwbio, cw0102) were used. The intensities of the protein bands were scanned using the ImageQuant LAS 4000 System (GE healthcare, UK).

PP2A activity assay

Cells were lysed with the ice cold lysis buffer 20mM imidazole-HCl, 2mM EDTA, 2mM EGTA, pH 7.0 with 10ug/ml each of aprotinin leupeptin, pepstatin, 1mM benzamidine, and 1mM PMSF and centrifuged at 2000 x g for 5 min at 4°C. The supernatants were used to assay phosphatase activity using a PP2A Immunoprecipitation Phosphatase Assay System kit (Millipore, 17-313) in accordance with the manufacturer’s protocols. After adding phosphopeptide and Ser/Thr assay buffer, parts of the samples were added 6nM Okadaic acid (Beyotime Biotechnology) to inhibit PP1/PP2A activity. The 96-well plates were measured the O.D. at 650nm using Power Wave XS2 (BioTek, Vermont, USA) and the absorbance values of samples compare to negative controls containing no enzyme.

Statistical analysis

The results were expressed as mean +/- SEM; the SEM values for these groups were analyzed on the basis of three independent experiments. Parametric variables of normal distribution were analyzed by either a two-tailed Student’s t-test or ANOVA with Bonferroni test as post-hoc test. Results were considered significant at p<0.05. Statistical analysis was performed using the SAS 8.2 statistical package (SAS Institute Inc., USA) and GraphPad Prism 5.01 (GraphPad software Inc., USA).

Primers used to determine PPP2r2c, housekeeping genes and tissue specificity expression

─ human

PPP2R2C

forward: 5’-CACTCCTGTCCACCAACGAT-3’,

reverse: 5’-TCACCTCCACCATCAGATCC-3’;

Rplp0 (36B4)

forward: 5’-AACTCTGCATTCTCGCTTCCT-3’,

reverse:5-ACTCGTTTGTACCCGTTGATG-3’;

beta-actin

forward: 5’-TCAAGATCATTGCTCCTCCTGAGC-3’,

reverse: 5’-AACGCAACTAAGTCATAGTCCGCC-3’;

─ mouse

PPP2R2C

forward: 5’-GATTACCGAACGAGACAAGAGG-3’,

reverse: 5’-GAGATGGAGTTGATGTGGTAGG-3’;

Rplp0 (36B4)

forward: 5’-AGATTCGGGATATGCTGTTGGC-3’,

reverse:5-TCGGGTCCTAGACCAGTGTTC-3’;

beta-actin

forward: 5’-AGAGCTATGAGCTGCCTGA-3’,

reverse: 5’-GGCATAGAGGTCTTTACGGATG-3’;

TUBB3 (Tubulin beta 3, brain)

forward: 5’- AGCAGTTCACAGCCATGTT-3’,

reverse: 5’- CCGATTCCTCGTCATCATCTTC-3’;

MYH6 (Myosin heavy chain 6, heart)

forward: 5’- GGATCCACTTTGGAGCTACTG-3’,

reverse: 5’- GCGTAGTCGTATGGGTTGTT-3’;

ALB (Albumin, liver)

forward: 5’- TTAGTGAGGTGGAGCATGAC-3’,

reverse: 5’- GTCTCAGCAACAGGGATACA-3’;

SGCD (Sarcoglycan, delta (dystrophin-associated glycoprotein), muscle)

forward: 5’- CGACCAGGTAATGCCCTATAC-3’,

reverse: 5’- ACGACCACTTCACTGTCATC-3’;

KRT5 (Keratin 5, skin)

forward: 5’- TGACACATCTGTGGTCCTTTC -3’,

reverse: 5’- CTGTTGCAGCTCCTCATACTT -3’;

SFTPA1 (surfactant associated protein A1, lung)

forward: 5’- AAGGGAGAGCCTGGAGAAA-3’,

reverse: 5’- AGTTGACTGACTGCCCATTG-3’;

OSAP (Ovary-specific acidic protein, ovary)

forward: 5’- CAGTCAGTGCTGGTGGATATT-3’,

reverse: 5’- CCGATTCAGCTTCCGTTACA-3’;