Distinct effects of epirubicin, cisplatin and cyclophosphamide on ovarian somatic cells of prepuberal ovaries

Characterization of the ovarian somatic cell populations in culture

Ovarian somatic cells obtained from 8dpp ovaries were cultured for 4 days under the conditions described in M&M. From 2 up to 4 days of culture, a mixture of four distinct cell types was observed under a phase contrast (PH) microscope. For the most part, cells were a mash-up of loose confluent fibroblastoid cells with multipolar shape mixed with cells showing a flattened polygonal shape typical of epithelial cells (Figure 1A, 1B). However, colonies of compact small size cells or large epithelioid cells with small nucleus were also detected (Figure 1C, 1D).

Cells were analyzed by RT-PCR, WB, IHC and IF, at different culture times (between day 1 and day 4) for the expression of markers of epithelial, granulosa (GCs) and follicular theca (TCs) cells (pan-CKs; AMH and FOXL2; Gli1, LHCGR, CYP17A1 and αSMA, respectively).

RT-PCR analyses showed that the transcripts of all these proteins were expressed at significant levels by the cultured cells at T0 (Figure 1E). The expression of FOXL2 and LHCGR, was confirmed at protein level by WB (Figure 1F–1H). Except for increasing level of CYP17A1 (a marker of steroidogenic TCs), no significant changes in the expression of all other markers during the culture period were observed (Figure 1E–1H).

IHC and IF showed that the about 40%–50% of the fibroblastoid cells and almost all dispersed and in colonies epithelioid cells, were positive for FOXL2. We considered such scattered cells as stromal precursor granulosa cells (pGCs), and the large epithelioid cells in compact colonies as granulosa cells (GCs), based on FOXL2 positivity, morphologies and on published observations. In fact, in early postnatal mouse ovaries it was previously described the presence of granulosa cells from follicles, activated immediately after birth and of a subset of stromal cells representing the precursors of granulosa cells that populate the cortical primordial follicles forming at this stage [18]. Of the remaining fibroblastoid cells about 35%–45% were αSMA positive (possibly pre-thecal cells, pTC) [19] while the rest (5%–15%) appeared negative for both markers. Double IF for FOXL2 and αSMA showed that these markers never overlapped. Finally, pan-CK positive cells corresponded to the epithelioid cells in small colonies (likely ovarian surface epithelium, OSE, cells) (Figure 1I–1N). As note, the percentage of the cells positive to these markers remained substantially unchanged during the culture time (data not shown).

IF on ovary sections from 8dpp mice confirmed the specificity of the FOXL2 and αSMA markers showing that only GCs of the various follicle types were FOXL2 positive, whereas αSMA was confined to the TCs layers of growing follicles (Supplementary Figure 1A, 1B). Similarly, GCs spreading out from in vitro cultured oocyte-free secondary follicles obtained from 16dpp mice showed morphological features and FOXL2 positivity like putative GCs (Figure 1O, 1P).

The Click-iT EdU proliferation assay performed on the cultured cells indicated that for the most part, the scattered putative pGCs, pTCs and OSE cells in colonies were proliferating, whilst GCs in large colonies and spreading out from secondary follicles were not (Figure 2).

Epirubicin induces apoptosis and extensive DNA damage in all ovarian somatic cells

In order to characterize the EPI effect on ovarian somatic cells, the cell cultures were exposed to 0.5 μM EPI (corresponding to about 0.3 μg/mL), a concentration in the high therapeutic range [20].

Propidium Iodide (PI) cells fluorescence, evaluated by flow cytometry, after 8 to 48 hrs of culture, indicated that, while in the control group the percentage of cells in sub-G1 phase (considered apoptotic cells) remained stable (1.46 ± 0.34%), it increased significantly in the presence of EPI from 16 hrs (6.1 ± 0.2%) onwards and reached 63.16 ± 4.05% at 20-24 hrs and 82.03 ± 1.52% at 48 hrs (Figure 3A, 3B).

In situ IF for the phosphorylated form of H2AX (γH2AX), a marker of DNA damage, showed that EPI caused a progressive rapid increase of the positive cells number, reaching 80% after 4 hrs of culture (CTRL = 3.3 ± 0.9% vs EPI 4h = 79.7 ± 2.4%) and maintained up to 95.33 ± 2.60% after 24 hrs (Figure 3C, 3D). These last results were confirmed by WB analyses (Supplementary Figure 2).

Cisplatin does not induce apoptosis in the ovarian somatic cells but causes stress-induced premature senescent in putative pGCs and pTCs

In order to analyze the effect of CS on ovarian cell populations, cultures were exposed to 10 μM CS (corresponding to about 3 μg/mL) up to 72 hrs. This concentration was chosen on the basis of our previous results [17], in the high therapeutic range [21, 22].

Flow cytometric analyses showed that, differently from EPI, CS caused only a slight increase of the percentage of apoptotic cells both after 48 hrs (CTRL = 1.46 ± 0.34% vs CS = 8.05 ± 1.29%), and 72 hrs (CTRL = 1.46 ± 0.34% vs CS = 12.85 ± 0.98%) of culture. At the same time, it was evident that CS treatment resulted in a progressive accumulation of cells in G2/M stage that peaked at 36 hrs (16 hrs: 47.32 ± 1.43%; 24 hrs: 58.51 ± 1.53%; 36 hrs: 73.45 ± 0.53%; 72 hrs: 72.92 ± 5.85%) (Figure 4A–4C). Such cell cycle arrest was confirmed by a marked decrease of the Ki67 (about 7-fold) and increase of p21 (about 8-fold) transcripts during the same time frame (Figure 4D, 4E) and by the Click-iT EdU proliferation assay (Figure 4F, 4G). Surprisingly, this assay showed that the majority of putative OSE cells continued to proliferate in spite of CS treatment (Figure 4G).

Observations under the PH microscope showed that, between 48 and 72 hrs of CS treatment, 60%–70% of the putative pGCs and pTCs acquired a large and flattened morphology, typical of stress-induced premature senescent (SIPS) cells (Figure 4H). Such morphological change was not evident in the putative GCs and OSE cells, these latter colonies showing appreciable size increase (not shown).

We also found that virtually all cells with large and flat morphologies following CS exposure, acquired high activity for the senescent associated βgal (SA-βgal), a typical feature of senescent cells [23] (Figure 4I, 4J). Conversely, putative GCs and OSE cells were SA-βgal positive both in the control and Cs-treated conditions (not shown).

Taken together these results indicated that the actively proliferating putative pTC and pGCs, present in our cultures, reacted to CS acquiring SIPS features rather than undergoing apoptosis, while putative GCs were resistant to the drug probably because contact inhibited. On the other hand, putative OSE cells were CS resistant despite active proliferation.

Since SIPS usually takes place following the activation of the DNA damage response (DDR) pathways, we next investigate the incidence of DNA damage in the cultured cells. IF staining for γH2AX showed a progressive increase of the number of positive cells up to about 60% of the total cells at 16 hrs (60.95 ± 4.22%) and 48 hrs (58.21 ± 3.31%) from the CS exposure followed by a rapid decrease to 27.73 ± 2.37% at 72 hrs (Figure 5A, 5B). It is likely that such a decrease testifies ongoing DNA repair since not increased apoptotic level was detected at this time (see the results above). The changes of γH2AX amount in the cultured cells detected by WB follow a similar pattern (Supplementary Figure 3A, 3B). The in situ staining pattern of MLH1 (a protein involved in the DNA mismatch repair system (MMR), showing the most part of cells positive and a progressive increase of staining intensity up to 72 hrs (Figure 5G, 5H), on one side confirmed the kinetics of DNA repair reported above for γH2AX and the other suggested the involved of MMR pathways in this process. Cells stained with antibodies against RAD51 and ERCC1 implicated in homologous recombination (HR) and nucleotide excision repair (NER), respectively, showed a generalized constant low/average positivity throughout the tested period that did not allowed any certain conclusion (Supplementary Figure 4A, 4B).

Interestingly, the γH2AX staining kinetics observed in situ occurred in all cultured cells except in putative CGs. In fact, these latter showed a constant background level of γH2AX staining like control (24 hrs: % γH2AX-positive scattered cells = 73.90 ± 1.17%; % γH2AX-positive OSE cells = 63.2 ± 0.71%; % γH2AX-positive GCs = 1.4 ± 0.16%) (Figure 5C–5E), suggesting resistance to CS-induced DNA damage. GCs spreading out from in vitro cultured oocyte-free secondary follicles treated with CS showed background γH2AX staining like putative GCs (24 hrs: % γH2AX-positive GCs from secondary follicles = 1.81 ± 0.20%) (Figure 5F).

Cisplatin induces markers of SIPS in cultured ovarian fragments and ovaries in vivo

To exclude that the senescence response by the ovarian cells to CS was due to the tissue disaggregation and/or to the in vitro conditions, we next analyzed the expression of stress-senescent markers in cultured CS-treated fragments of ovaries and in ovaries dissected from in vivo CS- treated mice. For these analyses, we could employ only qRT-PCR for p21 and ki67, because detection of morphological changes and staining for SA-βgal activity resulted unreliable both in the ovarian fragments and whole ovaries. The results showed that in ovarian fragments exposed to CS for 72 hrs, the levels of ki67 mRNA were significantly reduced about 2-fold and that of p21 mRNA increased about 9-fold in comparison to control (Figure 4D, 4E). A similar up regulation of the p21 transcripts in comparison to control was observed in ovaries after 72 hrs and 96 hrs from CS injection, whereas the expression of ki67 did not change significantly (Figure 4D, 4E).

The effects of cyclophosphamide on the ovarian somatic cells are similar to that caused by cisplatin

In order to analyze the effect of CPM on ovarian cell populations, cultured cells were exposed to 10 μM of its active metabolite Phosphoramide Mustard (PM), for up to 120 hrs. This concentration (corresponding to about 3 μg/mL) was chosen on the basis of previous studies performed on the mouse ovaries [24], in the range of CPM therapeutic dosage [25].

Flow cytometric analyses showed that similarly to CS but with a slight delay, PM caused a modest increase of the percent of apoptotic cells after 72 hrs (CTRL = 1.46 ± 0.34% vs PM = 7.75 ± 2.18%) and 120 hrs (CTRL = 1.46 ± 0.34% vs PM = 15.61 ± 1.69%) in comparison to the control (Figure 6A, 6B). Moreover, a progressive arrest of cells in G2/M stage occurred, reaching 60.78 ± 1.68% after 120 hrs from PM addition to the culture medium (Figure 6A, 6C). At this time, cell cycle arrest in the PM-treated cells was confirmed by qRT-PCR analyses for Ki67 and p21 genes (Figure 6D, 6E) and the proliferation assay (Figure 6F, 6G).

Observations under the PH microscope evidenced PM-induced morphological changes and increased SA-βgal activity in the cultured cells attributable to SIPS and comparable to that induced by CS (Figure 6H, 6J). Also, the pattern of cell positivity to γH2AX in presence of PM, resembled that described for CS, although with faster kinetics in DNA damage and apparent repair (Figure 7A, 7B). As note, like for CS, putative GCs in large colonies and GCs from secondary follicles appeared resistant to the DNA damage detectable by γH2AX staining caused by PM (16 hrs: % γH2AX-positive scattered cells = 76.81 ± 1.16%; % γH2AX-positive OSE cells = 68.05 ± 0.92%; % γH2AX-positive GCs = 1.6 ± 0.23%; % γH2AX-positive GCs from secondary follicles = 2.04 ± 0.20%) (Figure 7C–7F).

Finally, qRT-PCR performed on ovarian tissue fragments showed that after 72 hrs of culture, PM exposure induced about a 4-fold increase of the level of p21 mRNA and a 1.7-fold decreased of the Ki67 mRNA levels in comparison to control (Figure 6D, 6E).

LH does not protect from EPI-induced apoptosis and does not prevent CS-induced SIPS but favors DNA repair

In previous studies, we reported that 200 mIU/mL LH, through its action on the somatic cells of prepuberal ovaries, protected PMF-enclosed oocytes (POs) from CS-induced apoptosis [17]. On the other hand, here we report that LH was unable to protect these oocytes from EPI-induced apoptosis (% healthy POs 24 hrs: CTRL = 95.24 ± 0.49%; LH = 96.53 ± 0.76%; EPI = 22.7 ± 5.02%; EPI+LH = 24.72 ± 7.10%) (Supplementary Figure 5). The distinct effects of EPI and CS on the somatic cells of prepuberal ovaries reported in the present paper, prompted us to investigate whether the hormone interfered with some of the drug effects.

The results in Supplementary Figures 6 and 7 shown that LH was unable to counteract the DNA damages induced by EPI (Supplementary Figure 6A–6D) and the occurrence of all stress-induced processes caused by CS in the ovarian somatic cells (Supplementary Figure 7A–7H). Moreover, LH did not have a detectable effect on the initial DNA damage caused by CS measurable by γH2AX staining. However, the hormone appeared to significantly accelerate the kinetics of DNA repair occurring in CS-treated cells evaluated both by γH2AX (Figure 8A–8D) and MLH1 (Figure 9A, 9B) staining whereas it did not impinge upon the RAD51 and ERCC1 staining (Supplementary Figure 8A, 8B).

Animals

CD-1 and transgenic p18 GFP/c-Kit [38] mice were housed and mated under standard laboratory conditions in an environmentally controlled room and treated using humane care in order to inflict the least possible pain. All experiments were approved by the Institutional Animal Care and Use Committee (IACUC) and carried out according to the Italian and European rules (D.L.116/92; C.E. 609/86; European Directive 2010/63/EU); authorization n°391/2016-PR.

Compounds and antibodies

Epirubicin (EPI) and Cisplatin (CS) were purchased from Sigma-Aldrich and dissolved in water and DMSO, respectively. Phosphoramide mustard (PM), the active metabolite of Cyclophosphamide, from National Cancer Institute and dissolved in DMSO. Human recombinant LH was a gift from Merck KGaA (Germany).

The following primary antibodies were used: Tubulin (T9026, Sigma-Aldrich); GADPH (G9545, Sigma-Aldrich); LHCGR (sc-25828, Santa Cruz); FOXL2 (ab5096, Abcam); γH2AX (05-636, Millipore); pan-cytokeratin (pan-CK, Z0622, Dako); αSMA (A2547, Sigma-Aldrich); RAD51 (sc-8349, Santa Cruz Biotechnology); ERCC1 (sc-17809, Santa Cruz Biotechnology); MLH1 (sc-271978, Santa Cruz Biotechnology). HRP-conjugated secondary antibodies were as follows: donkey anti-goat (Jackson ImmunoResearch) (1:50000); goat anti-mouse (GE Healthcare) (1:5000); goat anti-rabbit (GE Healthcare) (1:5000). The following secondary antibodies were used for IF analysis: Cy3-labeled donkey anti-goat antibody (1:400); Alexa Fluor 488-labeled goat anti-mouse (Thermo Fisher Scientific) (1:500); Alexa Fluor 568-labeled goat anti-mouse (Thermo Fisher Scientific) (1:500); Alexa Fluor 488-labeled goat anti-rabbit (Thermo Fisher Scientific) (1:500).

In vivo treatment of animals

For each experimental group, twelve 8 days post-partum (dpp) CD1 mice were used. They were intraperitoneally injected with 30 μl of physiological solution or equal volume of CS (5 mg/Kg).

In vitro culture of ovarian somatic cells

Ovaries were collected from 8dpp CD1 mice, cleared of the surrounding tissues and incubated in 1 mg/mL collagenase type I (Sigma-Aldrich) in αMEM for 1 hr at 37°C in agitation. Following collagenase removal, the ovaries were suspended in the cultured medium (see below) and disaggregated by gently pipetting. Cell suspension was filtered through a 40 μm nylon filter (BD Falcon) while the retained tissue fragments were further incubated in 0.25% trypsin (Sigma-Aldrich) for 15 min at 37°C in agitation, disaggregated and filtered as above. The cellular suspensions were then mixed and finally plated at 30.000 cells/cm². Culture was carried out in αMEM (Aurogene) supplemented with 10% FBS (Gibco), L-glutamine, penicillin-G and streptomycin, pyruvic acid, N-acetyl-L-cysteine (all from Sigma-Aldrich) and ITS liquid media supplement (Gibco), at 37°C in 5% CO₂ in 95% humidified incubator. The day after ( = T0 time point), 0.5 μM EPI, 10 μM CS or 10 μM PM was added to the culture medium of the treated groups. Where indicated, 200 mIU/mL LH was also added to the medium 1 hr before drugs.

Images were acquired under phase contrast microscope (Leitz Diavert) equipped with a DS-Fi1 camera (Nikon).

Culture of ovarian fragments

Ovaries were collected from 4dpp transgenic p-18 GFP/c-kit mice as reported in Rossi, Lispi [17]. Briefly, each ovary was cleaned and fragmented in 8 pieces. Fragments were, then, plated at 37°C and 5% CO₂ in αMEM (Aurogene) supplemented with 10% FBS (Gibco), L-glutamine, penicillin-G and streptomycin, pyruvic acid, N-acetyl-L-cysteine and ITS liquid media supplement (all from Sigma-Aldrich). After 4 days in culture, the ovarian fragments formed a thin layer of tissue containing GFP-positive oocyte visible under a fluorescence microscope. At this time (T0 time point), drugs were added to the culture medium at the concentrations indicated above. For the co-treatments with LH and chemotherapeutic agent, cells were pre-incubated with LH 1 hr before the addition of the drug. The number of morphologically healthy GFP-positive oocytes with a diameter of 20 μm (POs) was scored at T0 and after 24 hrs of treatment under a Leica CTR 6000 microscope (Watzlar, Germany).

The values presented are the mean ± SEM of at least three independent experiments in which at least three fragments were scored for each experimental condition at T0 and after 24 hrs of culture.

Culture of follicular cells from secondary follicles

Ovaries were dissected from 16dpp CD1 mice, cleaned from the adipose tissues and placed in αMEM supplemented with 1mg/ml BSA (Sigma-Aldrich) and 25 mM HEPES (Gibco). They were punctured and minced in order to release follicles and those with more than one granulosa cells layer (early secondary follicles) were washed and transferred in culture medium using a glass micropipette to be cultured at 37°C in 5% CO₂ in 95% humidified incubator. Within 24 hrs, the follicle cells spread usually releasing the oocyte in the medium to form a compact epithelioid cell monolayer.

Flow cytometry

Adherent cells were collected and fixed in cold methanol/acetone (1:4) O.N. at 4°C. After incubation with RNase (100 μg/mL in PBS) for 20 min at room temperature, cellular suspension was marked with propidium iodide (1 mg/mL in PBS, from Sigma-Aldrich) for 20 min at room temperature. Samples were analyzed on a FACSCalibur (BD Biosciences) with Cell Quest Pro software (Becton Dickinson). In each sample, 10000 events were counted. Data analysis was conducted with FlowJo software (Tree Star).

Immunohistochemistry and immunofluorescence

For immunohistochemistry (IHC) and immunofluorescence (IF) on cultured cells, medium was removed and, after two-three washes in PBS, cells were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature. For IF analysis on ovarian sections, ovaries were collected and fixed in 4% PFA for 4h. After dehydration, tissues were embedded in paraffin and sectioned (5 μm sections) following standard procedures. After deparaffinization and hydration, antigen retrieval in citrate buffer (pH 6) was performed. Both cultured cells and ovarian sections were permeabilized with 0.1% Triton X in PBS for 10 min, blocked in 3% BSA for 30 min and then incubated with primary antibodies O.N. at 4°C: FOXL2 (1:200); αSMA (1:300); pan-CK (1:250); γH2AX (1:500); RAD51 (1:100); MLH1 (1:100); ERCC1 (1:100). Primary antibody binding was detected using fluorescent-dye conjugated secondary antibody (1 hr at room temperature). Hoechst was used as counterstain. Both cells and sections were mounted in PBS-glycerol (1:1) and analyzed by Leica DMI6000B microscope. For quantification of different cell populations in culture, at least 150 cells within randomly selected field were scored for a total of 500 cells in each separate experiment. For γH2AX staining, cells were considered positive if they displayed >4 nuclear dots or a fully stained nucleus [39, 40]; for each condition, at least 300 cells were scored in each separate experiment. For fluorescence intensity analysis, at least 300 cells were analyzed in each separate experiment using ImageJ software. The Correlated Total Cell Fluorescence (CTCF) for each cell was calculated using the following equation: CTCF = Integrated Density of selected cell – (Area of selected cell * Mean fluorescence of background readings). Data obtained were represented in figure as average of all cells analyzed.

Click-iT Plus EdU and SA-βgal staining

The ability of cells to proliferate was estimated using Click-iT Plus EdU (Cat. n. C10637) purchased from Molecular Probe according to the manufacturer’s instructions.

SA-βgal activity was detected as reported by Debacq-Chainiaux et al. [23]. Briefly, cells were fixed (2% formaldehyde/0,2% glutaraldehyde), and incubated with a staining solution, (40 mM citric acid/Na phosphate buffer, 5 mM K4[Fe(CN)6] 3H₂O, 5 mM K3[Fe(CN)6], 150 mM sodium chloride, 2 mM magnesium chloride and 1 mg/mL X-gal in distilled water). Staining was analyzed under a phase contrast microscope.

Total RNA extraction and cDNA synthesis

Briefly, RNA was extracted from cultured cells, tissue fragments or ovaries using TRIzol (Invitrogen) following the manufacturer’ instructions; RNA was then quantified with NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific). The first strand cDNA was synthesized from 500 μg of RNA template by TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGene Biotech) in a 20 μl reaction.

RT-PCR amplification

For PCR amplification, 50 ng of cDNA were used. PCR was performed using 0.5 μM of forward and reverse primers (obtained from Sigma-Aldrich) and PCR Master Mix kit (Thermo Fiser Scientific) in a total volume of 20 μl. Amplifications were performed using a PCR Thermal cycler (Mastercycler, Eppendorf) as follows: 1) initial denaturation at 95°C for 3 min, 2) followed by 35 cycles of denaturation at 95°C for 30 sec, primer annealing at 55°C (for GAPDH, AMH and LHCGR) or 60°C (for FOXL2, Gli1 and CYP17A1) for 1 min and primer extension at 72°C for 1 min, 3) finally, 7 min at 72°C to ensure extension of remaining single strands. The reaction products were analyzed by electrophoresis on 1,5% agarose gels and visualized by ethidium bromide staining under an UV light. GAPDH was used as internal control. GAPDH fw: AACTTTGG CATTGTGGAAGG, GAPDH rv: CCGTGTTCCTAC CCCCAATGTG; LHCGR fw: CCTGAGCATCTGTA ACACAG, LHCGR rv: TTCCTGAAAGCACAGCA GTG; Gli1 fw: TCCACAGGCATACAGGATCA, Gli1 rv: TGCAACCTTCTTGCTCACAC; CYP17A1 fw: TC TGGGCACTGCATCACG, CYP17A1 rv: GCTCCGA AGGGCAAATAACT; AMH fw: GCAGTTGCTAGTC CTACATC, AMH rv: TCATCCGCGTGAAACAGCG; FOXL2 fw: AAGCCCCCGTACTCGTACGTGGCGC TCATC, FOXL2 rv: GTAGTTGCCCTTCTCGAACA TGTC.

Real-time PCR (qRT-PCR)

30 ng of reverse-transcribed cDNA was used for Real Time polymerase chain reaction (PCR) using iTaq Universal SYBR Green Supermix (Biorad) and specific forward (F) and reverse (R) primers (from Sigma-Aldrich). Primers were used at a concentration of 0.5 μM and the reaction performed on a 7300 Real-Time PCR System (Applied Biosystems). The thermal cycling conditions were Data from the reaction were collected and analyzed using the 2^-ΔΔCt method. Relative quantization of gene expression was performed relating the signal in the treated group to that of the untreated group. GAPDH was used as internal reference. GAPDH fw: AACTTTGGCATTGTGGAAGG, GAPDH rv: CCGTGTTCCTACCCCCAATGTG; P21 fw: GCAGA TCCACAGCGATATCC, P21 rv: CAACTGCT CACTGTCCACGG; Ki-67 fw: AATCCAACT CAAGTAAACGGGG, Ki-67 rv: TTGGCTTGCTT CCATCCTCA.

Western blotting

For Western Blotting (WB) analysis, samples were lysed in a solution containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% NP-40, 5 mM EDTA, 0.5% sodium deoxycholate, 1 mM PMSF, 1mM sodium o-vanadate, and protease inhibitors (all from Sigma-Aldrich). Samples were homogenized on ice by ultrasonic homogenization and proteins concentration determined by Bradford assay.

Proteins (about 30 μg) were resolved on SDS-polyacrylamide gel and transferred to a PVDF transfer membrane (GE Healthcare). Blots were blocked in 5% non-fat dry milk in PBS-T (0.05% Tween 20 in PBS) for 1h at room temperature and then incubated with primary antibodies (in 1% milk in PBS-T) O.N. at 4°C: Tubulin (1:1000); GAPDH (1:2000); LHR (1:200); FOXL2 (1:1000); γH₂AX (1:1000). Membranes were, then, incubated with HRP-conjugated secondary antibody for 1 h at room temperature and signals detected by peroxidase reaction using Clarity Western ECL Substrate (Biorad). Immunoblots were quantitatively evaluated using ImageJ software (NIH).

Statistical analysis

Data were analyzed with GraphPad Prism (software version 7.0, San Diego, CA). Results were given as mean ± SEM and P value was determined by one-way Anova and Bonferroni post-analyses. Statistical significance was based on P value: *p< 0.05, **p<0.01, ***p< 0.001, ****p<0.0001; a = p< 0.05, b = p<0.01, c = p< 0.001, d = p<0.0001.