Intermediate metabolites of the pyrimidine metabolism pathway extend the lifespan of C. elegans through regulating reproductive signals

Intermediate metabolites in the pyrimidine metabolism pathway increase the lifespan of C. elegans

To dissect the mechanism by which the pyrimidine metabolism pathway (Figure 1A)regulates lifespan, we detected the effect of intermediate metabolites in this metabolic pathway on the lifespan of C. elegans by feeding worms these endogenous small molecules. We found that feeding animalsthymine, β-aminoisobutyrate, orotate, uridine and cytidine at a concentration of 0.5 mM on Escherichia. coli OP50, which were heat-inactivated to avoid the catalysis of compounds by bacteria, could significantly extend lifespan by 15.2, 9.69, 14.8, 9.83, 7.87%, respectively, compared with the nontreated control (Figure 1B–1F). By contrast, treatment with uracil and thymidine at the same concentration had no effect on lifespan (Figure 1G–1H). These data suggest that the pyrimidine metabolism pathway plays an important role in regulating the lifespan of C. elegans. We also found that worms treated with 0.5 mM uridine and cytidine exhibited 5-fluro-2′-deoxyuridine (FUdR) resistance, as 10 μM FUdR could not prevent self-fertilization. Therefore, in all subsequent lifespan analyses using uridine and cytidine, animals were maintained on the plates without FUdR.

Figure 1. The intermediate metabolites of the pyrimidine metabolism pathway extended the lifespan of C. elegans. (A) Schematic representation of the pyrimidine metabolism pathway. (B–H) Lifespan of worms treated with 0.5 mM (B) β-aminoisobutyrate (red), (C) orotate (red), (D) thymine (red), (E) uridine (red), (F) cytidine (red), (G) thymidine (red), (H) uracil (red), and vehicle (gray) at 20 °C. The treatments were administered beginning on day 1 of adulthood. Lifespan was analyzed using the Kaplan-Meier test, and P values were calculated using the log-rank test; no significant difference was abbreviated as n.s. Data are representative of at least two independent experiments, and lifespan values are listed in Supplementary Table 1.

Essential genes in the pyrimidine metabolic pathway regulate the aging of C. elegans

In C. elegans, dpyd-1 encodes the C. elegans ortholog of human dihydropyrimidine dehydrogenase (DPYD), which is the first and rate-limiting enzyme for the metabolism of thymine to 5,6-dihydrothymine [18]. We detected that knockdown of the dpyd-1 gene by RNAi, which dramatically decreased the mRNA level, extended the lifespan of worms (Figure 2A and 2D).

Figure 2. Characterization of the genes involved in the pyrimidine metabolism pathway as aging-related genes. (A–C) The effect of (A) dpyd-1 RNAi (red) and (B) upp-1 RNAi (red) on lifespan. (C) Lifespan of wild-type N2 exposed to control, dhod-1 RNAi, and dhod-1 RNAi with orotate supplementation. Lifespan values of repetitions are listed in Supplementary Table 1. (D) dhod-1, dpyd-1, and upp-1 RNA levels in whole worms after treatment of C. elegans with RNAi against dhod-1, dpyd-1 and upp-1, respectively, versus control RNAi. (mean ± SD, n=3, *** P<0.001, Student’s t test).

Similarly, the C. elegans UP homologous protein (UPP-1) exhibits both uridine and thymidine phosphorylase activity [19]. We found that lifespan was significantly extended (Figure 2B and 2D) following the exposure of C. elegans to upp-1 RNAi bacteria.

Furthermore, the C. elegans DHODH (dihydroorotate dehydrogenase (quinone)) homologous protein DHOD-1 catalyzed the transition of dihydroorotate to orotate [20]. We observed that the lifespan of C. elegans was significantly decreased following exposure to dhod-1 RNAi (Figure 2C and 2D). Additionally, we found that the decreased lifespan caused by dhod-1 impairment could be rescued by supplementation with 2 mM orotate (Figure 2C). In previous experiments, metabolites were applied at a concentration of 0.5 mM when feeding heat-inactivated OP50. However, for RNAi experiments, in which bacteria cannot be inactivated, 2 mM was used to compensate for the loss caused by the portion of treatments metabolized by live HT115 bacteria.

However, the RNAi knockdown of upb-1, a gene that catalyzes the transition of dihydrothymine to β-aminoisobutyrate [21], had no effect on the lifespan of treated worms (Supplementary Figure 1A and 1B, Supporting information). One possibility is that upb-1 is involved in several metabolic pathways, and its loss of function may cause some metabolite variations instead of exclusive changes in the levels of β-aminoisobutyrate. Accordingly, these results were consistent with a direct effect of metabolites, including thymine, uridine, cytidine, and orotate, on longevity.

Thymine regulates aging via a mechanism dependent on the transcription factor FOXO/DAF-16 and the nuclear receptors DAF-12 and NHR-49

Thymine is a representative intermediate metabolite in the pyrimidine metabolism pathway, and it is a stable molecule that had the best effect on lifespan extension among all the metabolites that benefited the longevity of C. elegans. Therefore, we chose thymine to systematically explore the molecular mechanism of the pyrimidine pathway. We exposed wild-type N2 worms to different concentrations of thymine and found that animals raised on plates containing 2 mM of thymine showed the largest lifespan extension of 18.3% (Figure 3A). Worms exposed to 10 mM and 0.5 mM also had moderately extended the lifespan (Figure 3A). At the lower concentrations of 0.1 and 0.05 mM, no lifespan extension was observed (Figure 3A). Therefore, thymine was applied at a concentration of 2 mM in all subsequent experiments.

Figure 3. Lifespan extension induced by thymine treatment is mediated by the nuclear receptors DAF-12 and NHR-49, and the transcription factor DAF-16/FOXO. (A) Effects of thymine supplementation at increasing concentrations (0.05-10 mM) (P value determined by log-rank tests). (B) Age-related movements of worms treated with 2 mM thymine and vehicles. Data are the mean ± SD; * P <0.05 (Student’s t test). (C–F) Lifespan analysis in (C) daf-12 (rh274), (D) daf-16 (mu86), (E) nhr-49 (gk405), and (F) skn-1 (zu67) worms treated with 2 mM thymine (red) and vehicle (black), on heat-inactivated E. coli OP50 (P value by log-rank test). Lifespan values of replicated experiments are summarized in Supplementary Table 1. (G) QPCR analysis of the mRNA level of target genes of daf-12, daf-16 and nhr-49 in C. elegans treated with 2 mM thymine versus control. Data are the mean ± SD, n=3, * p<0.05 (Student’s t test). (H–I) Images and quantification of GFP fluorescence. *p < 0.05; n=30 (Student’s t test).

To assess whether healthspan was affected, we measured an age-related phenotype, body movement, which is one of the most obvious behavioral abnormalities associated with nematode aging [22]. We analyzed the body movement of animals treated with or without 2 mM thymine. Our results showed that body movement progressively declined during aging, while the decrease in body movement with aging was delayed by thymine (Figure 3B).

To explore whether and to what extent known transcriptional modulators of lifespan might contribute to the longevity phenotype caused by thymine, we performed survival analyses of different mutants. SKN-1, a homolog of mammalian Nrf2 (nuclear factor-erythroid related factor 2) [23], appeared dispensable for thymine-mediated lifespan extension, as thymine could further increase the lifespan of the skn-1 mutant; moreover, the expression of a target gene of skn-1 (gst-4) and the P_gst-4::GFP reporter were not significantly different between animals treated with or without 2 mM thymine. (Figure 3F and Supplementary Figure 2). The C. elegans DAF-16 [24], nuclear receptor PPARα homolog NHR-49 [25] and steroid nuclear receptor DAF-12 [26] appeared to be involved since the impairment of nhr-49, daf-12 and daf-16 abolished the lifespan extension induced by thymine (Figure 3C–3E). In addition, several major target genes of daf-16 (sod-3, dod-3 and lipl-4) [23, 27], daf-12 (card-6, lips-17 and fard-1) [28] and nhr-49 (acs-2, ech-1 and lbp-8) [29] were significantly increased when worms were exposed to 2 mM thymine (Figure 3G). Additionally, the expression of the P_sod-3::GFP reporter in transgenic worms that were exposed to 2 mM thymine was significantly higher than that in nonexposed worms (Figure 3H and 3I). Taken together, these results indicated that thymine-induced lifespan extension requires the function of DAF-12, NHR-49, and DAF-16.

The effect of thymine on lifespan extension may be conferred by a reduction in germline signaling

We next dissected which longevity pathway is required for the lifespan extension induced by thymine through testing its effects in corresponding mutants. The ability of the Notch signaling pathway to sense nucleotide abundance is reminiscent of glp-1 [30], which encodes a Notch family receptor and is essential for the mitotic proliferation of germline cells [31]. The glp-1 loss-of function (lf) mutants have obviously prolonged lifespan when maintained at the nonpermissive temperature due to failed germline proliferation, which is dependent on the transcriptional activities of DAF-16, DAF-12, and NHR-49 [16, 32, 33]. Therefore, we first tested whether the longevity benefit of thymine was mediated by the Notch signaling pathway. Treatment with 2 mM thymine failed to further increase the lifespan of glp-1 mutants (Figure 4A), suggesting that thymine might regulate the germline signal to extend lifespan. The downregulation of germline signaling extends lifespan, usually accompanied by a decrease in the production of progeny [34]. However, we did not find that thymine decreased the daily progeny production, total progeny and germ cells of each worm (Figure 4E–4H). One possible explanation is that thymine does inhibit reproductive signals, but this inhibition does not reach a significant extent to affect the amount of eggs laid. Reduced reproductive signals is usually accompanied by a change in lipid metabolism [35]. To determine whether thymine affects fat metabolism, we used Oil-Red-O (ORO) staining. We found that wild-type animals treated with 2 mM thymine had significantly increased ORO staining (Figure 4I).

Figure 4. The lifespan extension induced by thymine depends on reproductive signals. (A–D) Lifespan analysis of (A) glp-1 (e2144), (B) daf-2 (e1370), (C) sir-2.1 (ok434), and (D) eat-2 (ad1116) animals treated with 2 mM thymine (red) and vehicle (black), on heat-inactivated E. coli OP50 (log-rank test). Lifespan values of replicated experiments are summarized in Supplementary Table 1. (E) The number of daily progeny and the total number of progeny of wild-type N2 worms treated with 2 mM thymine or vehicle. (F, G) DAPI-stained image of worm gonads. (H) Quantification of germline stem cells in wild-type N2 animals treated with 2 mM thymine or vehicle; n.s. not significant (Student’s t test). (I) Quantification of ORO staining. Mean ± SD.; n ≥ 30 per condition; P value was calculated using Student’s test; no significance is abbreviated as n.s. *p < 0.05, **p < 0.01, ***p < 0.001.

DAF-16 is downstream of several signaling pathways in addition to the reproduction signaling pathway, such as the IGF signaling pathway [24]. To explore whether thymine contributes to lifespan extension by influencing the IIS signaling pathway in a DAF-16-dependent manner, we detected the effect of thymine on long-lived mutants of the insulin-like receptor daf-2. We observed that the lifespan of daf-2 was significantly increased by thymine treatment, suggesting that the lifespan extension induced by thymine might not depend on the IIS pathway (Figure 4B).

The activation of DAF-16 by thymine was reminiscent of the silent information regulator 2 (SIR2), which encodes a nicotinamide adenine dinucleotide (NAD)-dependent deacetylase. SIR-2.1 could bind to DAF-16 and extend lifespan in a 14-3-3 protein-dependent manner [36]. We investigated whether SIR-2.1 mediated the lifespan extension caused by thymine using a null mutant sir-2.1 strain. Thymine extended the lifespan of the sir-2.1 mutant, indicating that SIR-2.1 was dispensable for thymine-mediated lifespan extension (Figure 4C).

Dietary restriction (DR) plays a significant role in the aging process in a wide range of species. The nuclear receptor NHR-49 and the transcription factor DAF-16 [37, 38], which function as mediators of the lifespan extension induced by thymine, were activated to respond to low energy and modulate lifespan under starvation conditions. Therefore, to determine whether the ability of thymine to extend lifespan was related to an effect similar to DR, we used a pharyngeal pumping defective eat-2 mutant, which was considered DR-constitutive due to its reduced food intake [39]. As shown in Figure 4D, thymine treatment significantly increased the mean lifespan of the eat-2 mutant, indicating that thymine acted through mechanisms different from the DR related mechanisms to extend the lifespan of C. elegans.

Other pyrimidine intermediates extend the lifespan of C. elegans in a similar mechanism mediated by thymine

In addition to thymine, other metabolites of the pyrimidine metabolism pathway, including β-aminoisobutyrate, uridine, cytidine and orotate could promote the lifespan of C. elegans. We tested whether the mechanism contributing to thymine-induced lifespan regulation was also involved in the lifespan extension induced by other pyrimidine intermediates. Our results revealed that β-aminoisobutyrate, uridine, cytidine, and orotate failed to further increase the lifespan of glp-1 (Figure 5A–5D) and daf-12 (Figure 6) mutants, which represent the reproduction signaling pathway. Similarly, the lipid content of wild-type worms was significantly increased when animals were exposed to 0.5 mM β-aminoisobutyrate, uridine, cytidine, and orotate (Figure 5E). Moreover, similar to the effect of thymine on reproduction, these metabolites could not affect germline stem cells of C. elegans (Figure 5F and 5G). Collectively, these results demonstrated that pyrimidine intermediates increased the lifespan of C. elegans by influencing the reproduction signaling pathway rather than by directly influencing fecundity.

Figure 5. Intermediate metabolites in pyrimidine metabolism influence the lifespan of C. elegans through regulating reproductive signals. (A–D) Lifespan analysis of glp-1 (e2144) animals treated with 0.5 mM (A) β-aminoisobutyrate (red), (B) cytidine (red), (C) orotate (red), (D) uridine (red), and water (black) on heat-inactivated E. coli OP50 (P value by log-rank test). The replicated data are summarized in Supplementary Table 1. (E) Quantification of ORO staining. Mean ± SD.; n ≥ 30 (Student’s t test). (F) DAPI-stained image of the gonads of N2 worms treated with 0.5 mM β-aminoisobutyrate, cytidine, orotate, and uridine and the untreated control. (G) Quantification of the germline stem cells in wild-type N2 worms treated with or without 0.5 mM of the metabolites. P values were calculated using Student’s t test.

Figure 6. Intermediate metabolites in pyrimidine metabolism extended adult lifespan in a DAF-12-dependent manner. (A–D) Lifespan of daf-12 (rh274) animals treated with 0.5 mM (A) β-aminoisobutyrate, (B) cytidine (red), (C) orotate (red), (D) uridine (red), and vehicle (black). The P value was calculated by the log-rank test. Replicates of these experiments and statistical details are summarized in Supplementary Table 1.

Chemicals and strains

The strains used for this publication were obtained from the Caenorhabditis Genetics Center (CGC) (University of Minnesota, USA). Worms were maintained on nematode growth media (NGM) plates at 20 °C with E. coli OP50 bacteria as previously described unless otherwise stated [53]. All of the strains used in this study were: Bristol N2 wild-type, CF1038 daf-16(mu86)I, VC199 sir-2.1(ok434)IV, DA1116 eat-2(ad1116)II, CB1370 daf-2(e1370)III, AA89 daf-12(rh274) X, VC870 nhr-49(gk405) I, CF1903 glp-1(e2144) III and EU1 skn-1(zu67) IV.

All chemicals were purchased from Sigma-Aldrich (Munich, Germany), and resolved in PBS. NGM plates containing compounds were equilibrated overnight before use.

RNA interference experiments

For RNAi gene knockdown experiments, we used E. coli HT115 as the food source for C. elegans as previously described [54]. The clones for dpyd-1, upp-1, dhod-1, and upb-1 were derived from the Ahringer library (Source Bioscience, Nottingham, UK). For upp-1^(##) RNAi, the designated fragment was obtained by amplification from genomic DNA with primers (forward, 5′- TTTTGACCCGTTAGTTGTCATGC -3′; reverse, 5′- ATCTCCATCCATACGATTCAAAAGA -3′) and subcloning into the L4440 feeding vector (pPD129.36). Then, the resulting plasmids were transformed into the HT115 (DE3) RNase III-deficient E. coli strain [55]. HT115 bacteria transformed with RNAi vectors (L4440) were grown at 37 °C in LB with 100 μg mL^-1 ampicillin. Then, freshly prepared bacteria were spotted on NGM plates with 1 mM isopropyl-B-D-thiogalactoside (IPTG) and 100 μg mL^-1 ampicillin. In experiments before treatment, synchronized L1 larvae were transferred to fresh plates with gene-specific RNAi bacteria.

Lifespan assay

All strains were grown on NGM plates for 2-3 generations without starvation. All lifespan assays were performed at 20 °C except CF1903, according to standard protocols and as previously described [53]. In brief, 100 late L4 larvae or young adults were transferred to fresh plates containing 10 μM 5-fluro-2′-deoxyuridine (FUdR, Sigma) and the respective compounds and scored every day. To determine the lifespan of the temperature-sensitive mutant CF1903, L1 worms were incubated at 20 °C for 12 h, then transferred to 25 °C until L4 larvae or young adulthood, and then returned to 20 °C for the remainder of the lifespan [13]. To ensure drug potency, animals were transferred every second day. Experiments were repeated at least twice. The mean, SEM, P value and lifespan value were summarized in Supplementary Table 1 in the Supporting Information.

Movement assay

Movement assays were performed as previously described [22, 53]. Briefly, 100 late L4 larvae or young adults were transferred to fresh plates with or without compound and maintained as described in the lifespan assay. When tapping plates, the worms moving in a continuous, coordinated sinusoidal way were characterized as fast movement; otherwise, the worms were classified as a nonfast movement.

Fertility assay

Single L4 or young adults were transferred to single plates with or without compound and subsequently transferred every 24 h to a fresh plate. The offspring yielded by each worm on each day were allowed to hatch and were counted. For every experiment, more than 30 worms were used, and the experiments were conducted three times.

Quantitative RT-PCR assay

Total RNA was extracted using RNAiso Plus (Takara) based on the phenol-chloroform extraction method. Afterward, the RNA was quantified and converted cDNAs using a high capacity cDNA transcription kit (RK20400, ABclonal) following the manufacturers' protocol. mRNA levels were quantified in a SYBR Green Select Master Mix (RK21203, ABclonal) on a CFX96 real-time system (Biorad). For every experiment, biological triplicates (starting from RNA isolation) and technical triplicates were performed. The results were calculated by the 2^-ΔΔCt method, and normalized to the reference genes cdc-42 [56]. P values were calculated using a two-tailed Student’s t test. The primers used in this publication are summarized in Supplementary Table 2 in the Supporting Information.

Germ cell number quantification

Synchronized worms grown on plates with or without treatment were collected 12 h post-L4. Worms from each condition were washed three times with M9 buffer and dissected in M9 buffer with 5 mM imidazole under the dissection light microscope, transferred to a slide and freeze cracked. Gonads were stained using 4,6-diamidino-2-phenylindole (DAPI) as previously described with some modification [57]. Briefly, gonads were fixed in -20 °C MeOH for 10 min, washed twice in PBST (PBS with 0.1% Tween 20), and stained with 0.5 μg/ml DAPI for 10 min. Then, the gonads were washed twice in PBST before imaging. Imaging was performed with a Nikon Ti2-U microscope, and germ cell nuclei were manually counted from the distal tip to the beginning of meiotic entry. At least 20 animals were used for each experiment, and each experiment was repeated at least twice.

Oil red O staining and quantification

ORO staining of fixed worms was conducted as previously described [58]. ORO-stained worms were mounted onto 2% agar pads and imaged at 20× magnification using a Nikon Ti2-U fluorescence microscope. The ORO intensity per worm was measured using Image-Pro-Plus processing software. Mean intensity values in arbitrary units (a.u.) were graphed using GraphPad Prism, and statistical significance was determined using a two-tailed Student’s t test. At least 30 animals were used for each experiment, and each experiment was repeated at least twice.

Green fluorescent protein quantification and visualization

For the quantification of SOD-3 and GST-4, synchronized L1 larvae of CF1553 (muIs84 [Psod-3::GFP, rol-6]) and CL2166 (dvIs19 [(pAF15)gst-4p::GFP::NLS]) were transferred to compounds treated and untreated plates for 55 h. Worms were anesthetized in M9 containing 10 μM levamisole and mounted on 2% agar pads. The GFP fluorescence of worms was directly observed with a Nikon Ti2-U fluorescence microscope. At least 30 animals were used for each experiment. For GFP quantification, images were analyzed by ImageJ.

Determination of pyrimidine intermediates concentrations by HPLC/MS

The strains were cultured for 2-3 generations prior to collection. The samples were prepared as previously described [13]. For sample treated with metabolites, synchronized L1 larvae were grown at the plates with or without metabolites until young adult for harvest. For glp-1 mutants, synchronized L1 larvae were incubated at 20 °C for 12 h, then transferred to 25 °C to eliminate germ cells, until young adult stage for harvest, as well as corresponding control samples were treated via the same procedures. All samples were collected through M9 buffer, and then immediately flash frozen in liquid nitrogen and stored at -80°C until extraction.

Metabolites form C. elegans samples were extracted four times with 800 μL of precooled MeOH / H2O (2:1) using a TissueLyser at 75 Hz for 120 s. All extracts were subjected to centrifugation (12000 rpm for 10 min at 4 °C), supernatant was evaporated to dryness with a vacuo at a low temperature and dissolved in 400 μL MeOH / H2O (2:1) for LC/MS analysis.

Liquid chromatography was performed using a reversed-phase C18 column (Eclipse Plus C18, Agilent, 5μm, 150×2.1 mm diameter column) with a flow rate of 300 μL/min at room temperature, and 3μL of sample was injected. Eluent A was ACN, eluent B was H₂O and eluent C was MeOH. The initial eluent consisted of 1% solvent A and 1% solvent C; the percent of buffer A and C were then gradually increased to 10% in 2 min, held there for 4 min, and then returned to the initial condition in 0.1 min, and held there for 10 min, the total run time was 16 min. Analyses were conducted using an Agilent Technologies 1260 (Agilent, Santa Clara, CA) system connected to an AB SCIEX QTRAP 4500 (ESI-MS/MS; Applied Biosystems, Foster City, CA).

Mass spectrometry analyses were conducted in negative ion multiple reaction monitoring (MRM) mode. The MS/MS parameters were optimized by infusion of individual compounds into the MS through a flow injection system.