Long non-coding RNA MEG3 promotes fibrosis and inflammatory response in diabetic nephropathy via miR-181a/Egr-1/TLR4 axis

MEG3 expression was upregulated in DN in vivo and in vitro

DN rat models were established to investigate the expression profile of MEG3 in DN. As respectively shown in Figures 1A and B, blood glucose level and urinary albumin excretion rate were significantly increased in DN rat models compared with those in the negative group. HE staining showed morphological glomerular changes in diabetic kidney tissue (Figure 1C). The expression level of fibrosis markers (Col-4 and FN) was increased in DN compared with that in the negative group (Figure 1D). MEG3 expression in DN was detected. QRT-PCR results indicated that MEG3 was upregulated in DN tissues (Figure 1E). MEG3 expression was measured in MCs stimulated by D-glucose at 5.5 (NC), 19.5 (LG), and 25 mmol/L (HG) and was found to increase with glucose concentration (Figure 1F). MEG3 expression in MCs cultured in D-glucose at 25 mmol/L was measured at 0, 12, 24, and 36 h. The results showed that MEG3 expression was upregulated with time (Figure 1G). The lncRNAs must be mainly expressed in the cytoplasm to act as an effective miRNA sponge. The qPCR and fluorescence in situ hybridization (FISH) results revealed that MEG3 was mainly localized in the cytoplasm of MCs (Figures 1H–1F). Thus, these results showed that MEG3 expression was upregulated in DN and mainly localized in the cytoplasm of MCs.

Figure 1.

MEG3 upregulated the expression of fibrosis-related proteins in MCs

Fibrosis changes are the pathologic bases of DN. MCs are the major participants in the development of fibrosis changes. MEG3 overexpression or knockdown was performed to study the effects of MEG3 on the fibrosis of MCs. The efficiency of lentiviral vector for MEG3 (LV-MEG3) and siRNA-MEG3 was determined by qPCR (Figures 2A–2B, respectively). First, the mRNA expression of fibrosis-related protein was quantified via qPCR (Figures 2C–2H), which revealed that MEG3 overexpression raised the mRNA expression level of TNF-α (Figure 2C), α-SMA (Figure 2D), and TGF-β1 (Figure 2E). MEG3 silencing decreased the mRNA expression of TNF-α (Figure 2F), α-SMA (Figure 2G), and TGFβ1 (Figure 2H). Western blot results showed that overexpression (Figure 2I) and silencing (Figure 2J) of MEG3 respectively enhanced and decreased the protein expression of TNF-α, α-SMA, and TGFβ1. Immunofluorescence analysis was also performed, revealing that MEG3 promoted fibrosis-related proteins in MCs (Figures 2K–2M). These findings demonstrate that MEG3 enhanced cell fibrosis and upregulated the expression of fibrosis-related proteins in MCs.

Figure 2.

MEG3 enhanced the expression of inflammatory cytokines in vitro and in vivo

Increased inflammation is a vital mechanism in the progression of DN. MEG3 overexpression or knockdown was performed to study the effects of MEG3 on the inflammatory response in DN.

The supernatant of MCs was collected, and DN-related inflammatory cytokines were measured by ELISA. The results revealed that MEG3 overexpression raised the concentrations of CRP (Figure 3A), IL-1β (Figure 3B), IL-6 (Figure 3C), and MCP-1 (Figure 3D). By contrast, MEG3 silencing decreased the concentrations of CRP (Figure 3E), IL-1β (Figure 3F), IL-6 (Figure 3G), and MCP-1 (Figure 3H). DN rats were injected with LV-MEG3 to detect the effect of MEG3 in vivo. ELISA results indicated that MEG3 overexpression increased CRP (Figure 3I), IL-1β (Figure 3J), IL-6 (Figure 3K), and MCP-1 (Figure 3L) expression in the kidney cortex of DN rats. Therefore, these data indicate that MEG3 overexpression promoted inflammation in DN.

Figure 3.

MEG3 interacted with miR-181a via a direct targeting and Ago2-dependent manner

CeRNA functions as a vital regulatory mechanism in DN [19,20]. StarBase v2.0 (http://starbase.sysu.edu.cn/index.php) was used to predict the potential target miRNA of MEG3. Some of the results are presented in Supplementary Table 1. MiR-181a plays a vital role in fibrosis and inflammation [21,22]. Thus, miR-181a, which contains two binding sites in MEG3 transcript, was selected as the prediction candidate. Luciferase reporter assay was performed to confirm the direct binding relationship between MEG3 and miR-181a. This binding relationship followed the basic complementary pairing principle. Thus, an MEG3 mutant-type reporter, in which binding sites between MEG3 and miR-181a were knocked out, was built. The results showed that the luciferase activity of MEG3 wild- and mutant-type reporter genes were respectively suppressed and not inhibited by mimic-miR-181a. The luciferase activity of MEG3 wild- and mutant-type reporter genes were respectively increased and decreased by miR-181a inhibitor (Figures 4A–4D). In addition, qPCR results revealed that MEG3 upregulation and downregulation respectively decreased and increased miR-181a expression (Figures 4E–4F). RNA-induced silencing complexes (RISCs) play a central role in posttranscriptional gene regulation. LncRNAs are a vital part of RISCs. MiRNAs bind their targets to repress and/or degrade RNA through RISC in an Ago2-dependent manner [23,24]. In the current study, RNA immunoprecipitation (RIP) assay results showed that MEG3 and miR-181a expression were increased in the anti-Ago2 group compared with that in the control group. The expression levels of MEG3 and miR-181a immunoprecipitated with Ago2 in anti-miR-181a were considerably decreased compared with those in the anti-normal IgG group (Figures 4G–4H). Thus, MEG3 interacted with miR-181a by a direct targeting and Ago2-dependent manner.

Figure 4.

MiR-181a inhibition promoted fibrosis and inflammatory response in MCs

MiR-181a was knocked down to study the effects of miR-181a on the fibrosis and inflammatory response in MCs. The efficiency of a miR-181a inhibitor was determined by qPCR (Figure 5A), which revealed that miR-181a inhibition enhanced the mRNA expression of TNF-α, α-SMA, and TGF-β1 in MCs (Figures 5B, 5C, and 5D). Western blot results revealed that miR-181a inhibition increased TNF-α, α-SMA, and TGF-β1 protein expression in MCs (Figure 5E). Subsequently, the supernatant of MCs transfected with miR-181a was collected and subjected to the measurement of inflammatory cytokines by ELISA. ELISA analysis results revealed that miR-181a inhibition increased the concentrations of CRP, IL-1β, IL-6, and MCP-1 in MCs (Figures 5F, 5G, 5H, and 5I). In summary, miR-181a inhibition enhanced the expression of fibrosis-related proteins and the concentration of inflammatory cytokines in MCs.

Figure 5.

MiR-181a increased the expression of fibrosis-related proteins and concentrations of inflammatory cytokines through Egr-1/TLR4 signaling

TargetScan (http://www.targetscan.org/vert_72/) was used to predict the potential target gene of miR-181a. Some of the results are presented in Supplementary Table 2. Egr-1 participates in the development of DN [25]. Thus, Egr-1, which contains one binding site in miR-181a transcript (Figure 6A), was selected for miR-181a candidate prediction. The binding relationship between miR-181a and Egr-1 follows the basic complementary pairing principle. If the binding sites are knocked out, then miRNA cannot bind the 3′UTR of the target gene. Thus, an Egr-1 mutant-type reporter, in which binding sites between miR-181a and Egr-1 are knocked out, was built. Luciferase reporter assay results showed that the luciferase activity of Egr-1 wild-and mutant-type reporter genes were and were not suppressed by mimic-miR-181a and miR-181a inhibitor, respectively. The luciferase activities of Egr-1 wild- and mutant-type reporter genes were respectively increased and decreased by the miR-181a inhibitor (Figure 6B). TLR4 is a gene located downstream of Egr-1 [26]. QRT-PCR and Western blot results showed that miR-181a inhibition increased the expression of Egr-1 and TLR4 (Figures 6C–6E). Rescuing experiment results showed that Egr-1 knockdown restored the marked upregulation of α-SMA in MCs transfected with miR-181a inhibitor. Moreover, ELISA indicated that Egr-1 knockdown restored the marked upregulation of IL-1β in MCs transfected with miR-181a inhibitor. Thus, miR-181a inhibition upregulated the expression levels of fibrosis-related proteins and concentrations of inflammatory cytokines through the Egr-1/TLR4 axis.

Figure 6.

MEG3 promoted Egr-1 expression, fibrosis, and inflammatory response by acting as a miR-181a sponge

MEG3 overexpression and knockdown were performed to further study the relationship between MEG3 and Egr-1. QRT-PCR and Western blot results revealed that the overexpression and silencing of MEG3 respectively increased and decreased the Egr-1 expression (Figures 7A–7D). QRT-PCR and Western blot were then performed by respectively co-transfecting LV-MEG3 and mimic-miR-181a into MCs to investigate whether miR-181a mediates the function of MEG3. The results showed that mimic-miR-181a restored Egr-1 upregulation by MEG3 overexpression (Figures 7E–7F). QRT-PCR and Western blot indicated that miR-181a overexpression attenuated the promotive roles of MEG3 on α-SMA (Figures 7G–7H). ELISA indicated that miR-181a overexpression attenuated the promotive roles of MEG3 on IL-1β (Figure 7I). In summary, MEG3 upregulated Egr-1 expression and enhanced fibrosis and inflammatory response by acting as a miR-181a sponge.

Figure 7.

MEG3 overexpression enhanced DN development in vivo

An overexpression-MEG3 DN rat model was built to further study the effects of MEG3 on DN in vivo. The establishment procedure is shown in Figure 8A. The efficiency of LV-MEG3 was detected in kidney tissues by qRT-PCR. The results indicated that MEG3 was successfully overexpressed in DN tissues after LV-MEG3 injection (Figure 8B). H&E staining results showed that MEG3 overexpression promoted DN development (Figure 8C) and increased urinary albumin excretion rate in DN rat models compared with that in the NC group (Figure 8D). The expression of miR-181a, Egr-1, and TLR4 was detected in kidney tissues to validate the participation of the miR-181a/Egr-1/TLR4 axis in the roles of MEG3 in DN. MEG3 overexpression decreased miR-181a expression (Figure 8E). QRT-PCR results indicated that Egr-1 and TLR4 expression was enhanced in DN tissues by LV-MEG3 injection (Figures 8F–8G). Western blot results indicated that MEG3 overexpression upregulated Egr-1 and TLR4 protein expression in DN tissues (Figure 8H). In addition, fibrosis-related genes were detected in the DN rat model. QPCR and Western blot results showed that TNF-α, α-SMA, and TGF-β1 were upregulated in the overexpression-MEG3 DN rat model (Figures 8I–8L). These results demonstrated that MEG3 overexpression enhanced DN development via the miR-181a/Egr-1/TLR4 axis.

Figure 8.

Cell culture

Cell culture was performed in accordance with a previous study [35]. RAW264.7 cells were cultured in RPMI1640 (Gibco, USA) supplemented with 20% FBS (Gibco, USA) in a 37 °C incubator with 5% CO₂. MCs were cultured in 5.5 mmol/L glucose, low glucose (LG, 5.5 mmol/L glucose plus 19.5 mmol/L mannitol), or high glucose (HG, 25 mmol/L glucose).

Cell transfection, lentivirus production, and transduction

A lentiviral vector for MEG3 was constructed by Bio-Link Gene (China). MiR-181a mimic, miR-181a inhibitor, and the corresponding controls were purchased from RiboBio (Guangzhou, China). The sequence of Egr-1 was cloned into a pcDNA3.1 vector. An empty vector functioned as negative control. Lipofectamine 3000 (Invitrogen, USA) was used for transfection in accordance with the manufacturer’s instructions.

ELISA

ELISA was performed in accordance with a previous study [36]. The supernatants of MCs and DN tissues in lysis buffer were collected and measured by CRP, IL-1β, IL-6, and MCP-1 ELISA Kits (Boster Bioengineering Co, China) in accordance with the manufacturer’s instructions.

Isolation of nuclear and cytoplasmic RNA

Nuclear and cytoplasmic RNA were isolated in accordance with a previous work [16]. Cytoplasmic and nuclear RNA were extracted and separated using a Nuclear and Cytoplasmic RNA Purification Kit (Norgen, USA). The isolated RNA was detected by qRT-PCR.

Fluorescence in situ hybridization

MCs were permeabilized with pre-cooled Triton X-100 (0.1%), and the slides were treated with 4% paraformaldehyde. Hybridization was then performed overnight with the lncRNA MEG3 probe. The cells were washed with SCC buffer. DAPI was used to stain the coverslip, and laser scanning confocal microscopy was utilized to test fluorescence.

QRT-PCR

All RNAs were isolated using the TRIzol reagent (Life Technologies, US). MRNA expression was measured via SYBR Green qPCR on an ABI 7300 real-time PCR machine. TNF-α, α-SMA, and TGF-β1 mRNA expression levels were respectively examined using the following specific primers: F-5′-TTGTCCTCAGTTTCGGGAGAT-3′ R-5′-CAAGTCTGTGTCCTGAACGC-3′; F-5′-CCTGTGTTGTGGTTTACACTGG-3′ R-5′- GGGGGAATTATCTTTCCTGGT; F-5′-AGGAGCAAAATCTGTCCGATCT-3′ R-5′- GTGGGGGAATTATCTTTCCT.

Bioinformatics analysis

The candidate target miRNA of MEG3 was analyzed using StarBase v2.0 (http://starbase.sysu.edu.cn/index.php). The candidate target genes of miR-181a were analyzed via the miRNA target prediction program miRNA.org (http://www.microrna.org/microrna/home.do).

Western blot

Protein (16–20 mg) extracted from the samples was utilized for Western blot. Antibodies utilized in the research included anti-TNF-α (1:1000; HK), anti-α-SMA (1:1000; HK), anti-TGF-β1 (1:1000; HK), anti-Egr-1 (1:1000; HK), and anti-TLR4 (1:1000; HK), and GAPDH (1:1000; USA) was utilized as loading control.

Luciferase reporter assay

Luciferase reporter assay was performed according to a previous study [37]. Specifically, pmirGLO-MEG-WT or pmirGLO-Egr-1-WT reporter plasmids (120 ng) and corresponding mutated vectors were transfected into 293T cells with miR-181a inhibitor or miR181a mimic (100 nM) with Lipofectamine 3000. In accordance with standard protocols, 293T cells were lysed 48 h after transfection, and luciferase activity was measured using the PicaGene Dual SeaPansy luminescence kit (Toyo Ink, Japan).

RIP assays

RIP assay was performed according to the literature [35] to determine the association between 1700020I14Rik and the RISC. The cell lysate was incubated with RIP immunoprecipitation buffer, which contained magnetic beads conjugated with Ago2 antibody (Abcam, USA) and NC IgG (Abcam, Cambridge, USA). RIP experiments were performed using Magna RIP kit (Millipore, USA). Co-precipitated RNAs were detected via qRT-PCR.

Immunofluorescence assay

For immunofluorescence analysis, the fixed cells were permeabilized with 0.1% Triton X-100 and blocked in 5% goat serum solution. The coverslips were added with primary antibodies against TNF-α (HK, 1:50), α-SMA (HK, 1:50), or TGF-β1 (HK, 1:50) at 4 °C overnight and then with Cy3-labeled secondary antibody (Proteintech, USA, 1:50) for 1 h at room temperature. After treatment with DAPI, the coverslips were sealed with glycerine. Images were observed with QImaging Micro-publisherTM 5.0 RTV (Olympus Corporation, Japan) and analyzed with Image-Pro Plus (Medium Cybernetics, Bethesda, MD, USA).

In vivo study

Eight-week-old male rats (SD rats) were purchased from Shanghai Laboratory Animal Center (Shanghai, China) and kept in an SPF lab. Two groups were set up (N = 12 for each group): DN + LV‐NC group and DN + LV‐MEG3 group. Streptozotocin (STZ) was used to establish the DN rat model. STZ was dissolved in 0.1 M citrate acid buffer, which was used to build DN rat models (50 mg/kg). The rats were injected once daily for six days. Blood glucose levels of >16.5 mmol/L were identified as successful DN models. Lentiviral –MEG3 (LV-MEG3) was used to establish the DN rat model. LV‐MEG3 or LV‐NC (120 µl) was injected into DN models. All DN rat models were sacrificed at the end of the third week after injection. The study was approved by the Ethics Committee of Qingpu Branch of Zhongshan Hospital Affiliated to Fudan University, and the procedures were performed in accordance with the regulations of the Ethics Committee.

Statistical analysis

Student’s t-test and one-way ANOVA were performed for statistical analysis by using the GraphPad Prism 5.0. Statistical data are expressed as mean ± standard deviation (SD). Differences were considered significant at P < 0.05.