Secreted frizzled-related protein 3 was genetically and functionally associated with developmental dysplasia of the hip

Patient collection and SNP genotyping in DDH patients and control

Between March 2014 and May 2016, a total of 386 patients with DDH retrieved from the department of orthopedic surgery and 558 healthy controls retrieved from physical examination department in the first affiliated hospital of Soochow University were enrolled to perform a case-control association study. All cases were confirmed to have unilateral or bilateral DDH (diagnosed according to clinical criteria and radiographic evidence). All controls had no symptom or history of DDH. Patients who had any systematic syndrome were excluded from the study. The study was approved by the ethical committee of the Soochow University, and written informed consent was obtained from the study subjects, whereby enrolled minors/children in the study would be signed by the guardians’ representative.

Genomic DNA was isolated from all the subjects either from buccal swabs with the DNA IQ System (Promega) or the peripheral blood with the NucleoSpin Kit (Macherey-Nagel GmbH and Co. KG). A case-control association study was performed by lab technician blinded to the sample status. SNPs in the current study were tag SNPs selected with the Haploview software (version 4.2). These loci were subsequently genotyped by Taqman assay both for cases and controls. Genetic analysis, data retrieval and the statistical processing are independently completed and reviewed by two persons. To ensure the accuracy of genotyping, 5% of the studied subjects were randomly selected for duplication and they had 100% concordance, indicating reliability of genotyping results.

FRZB expression in tissue samples of DDH patients and controls

Total RNA in clinical samples was isolated using RNA purification kits (ThermoFisher Scientific). Control samples were collected from patients with femoral head fracture or destructive amputation injury, and tissue samples of the hip joint were retrieved in the hip arthroplasty surgery or amputation surgery. A total 2 mg RNA was reverse transcribed to cDNA using a cDNA Reverse Transcription Kit (Applied Biosystems). FRZB expression in the tissue was measured by real-time PCR with gene-specific primers as follows: forward 5’-CTCATCAAGTACCGCCACTCGTG -3’, reverse 5’- CCGGAAATAGGTCTTCTGTGTAGCTC -3’ for the FRZB gene, and forward 5’-GAGTC AACGGATTTGGTCGT-3’, reverse 5’-TTGATTTTGGAGGGATCTCG-3’ for the endogenous control gene GAPDH. Real-time PCR was done as previously reported [17].

Immunofluorescence analysis of tissue sections

Immunofluorescence analysis of tissue sections was done as we previously described [17]. Briefly, sections were fixed in 4% PFA, washed with TBS-T, and then incubated with hyaluronidase (Sigma). After blocking with goat serum, sections were incubated with primary antibody for 2h at room temperature. PFA-embedded sections were deparaffinized and incubated in 1mM EDTA at 80° C for 15 mins for antigen retrieval. Primary antibodies for FRZB were diluted 1:200 and used (Abcam, Catalog No: ab273582). Immune complexes were detected with immunofluorescent secondary antibody using Goat Anti-Rabbit IgG H&L Alexa Fluor® 555 (Abcam, Catalog No. ab150078). DAPI (Beyotime biotechnology, Catalog No. C1002) was also used to detect the nucleus.

Different treatment of cultured BMSC and ATDC5 in vitro

BMSCs were acquired from mouse bone marrow as previously described [18]. Briefly, marrow aspirates (10-20 mL) were harvested and then transferred to plastic tubes. Retrieved BMSCs were further expanded in α-MEM medium [18]. Medium was changed every 2-3 days and Passage 2 BMSCs were used for the later experiments [19, 20]. For exogenous FRZB group, 50 ng/ml FRZB (R&D, Catalog No: AAB51298) was supplemented for two weeks into the medium. FRZB antibody (200ng/ml, Abcam, Catalog No: ab273587) was added into some cultures to neutralize FRZB in the medium. FRZB knockdown was performed using FRZB siRNA. FRZB siRNA (customized from GenePharma) and negative control(GenePharma, Catalog No. A06001) were acquired from GenePharma (Shanghai, China). Sequences used to construct FRZB-siRNA were 3’-GGAGATTCTAAAGTCCTCTTTCAAGAGAAGAGGACTTTAGAATCTC C-5’. The siRNAs were cloned into pGPU6/Neo (GenePharma). After confirmation of inhibiting efficacies, selected FRZB siRNA (150nM) or negative control was used to transfect primary ATDC5 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Isolated mRNAs were used to construct raw RNA sequence data obtained using an Illumina HiSeq™2000 machine [21]. The trimmed reads of mRNA profiles were further mapped with the Novoalign software (v2.07.11). mRNA expression profiles for the FRZB siRNA group and control group were profiled. Difference between FRZB siRNA and control group was analyzed using a paired two-sided test and the Bonferonni test. Fold changes and p-values were calculated for each mRNA profiled. Differentially enriched mRNAs were filtered with a fold change ≥ 2.0 and a false discovery rate (FDR) < 0.05 [21]. To predict the target pathways of differentially expressed mRNAs, Gene ontology (GO) categories of the predicted genes were analyzed using DAVID Bioinformatics Database, and pathway analysis (KEGG, Wiki, Reactome, Biocarta) was performed using the EnrichR web platform [21]. Validation of protein expressions were conducted with western blot for cells with different treatments as previously described. Anti-SOX9 antibody (Abcam, Catalog No: ab185966), Anti-ACAN antibody (Invitrogen, Catalog No: PA1-1746), Anti-ITGA8 antibody (Abcam, Catalog No: ab243027), Anti-ITGAV antibody (Abcam, Catalog No: ab179475) were used at the concentration of 1:200 dilution. Horseradish peroxidase (Jackson ImmunoLab) was used as the secondary antibody. GAPDH blots were used as control with GAPDH antibody (1:5000 diluted, Sigma).

Immunofluorescent analysis of ACAN (Invitrogen, Catalog No: PA1-1746) was performed to study the generated chondrocytes in different treatment. Images were observed with a confocal microscope (Leica, Japan). Expression of SOX9, Col2A1, GDF5 and Col10A1 after 2-week culture was quantified with RT-PCR. Chondrogenic tissues formed under different treatment was stained with alcian blue staining to detect proteoglycan production. Staining mages were taken with a light microscope (Leica Microsystems, Germany).

The expression of Wnt pathway genes(β-catenin, WNT3A and WNT8A), cartilage anabolic and catabolic markers (SOX9, Col1A1, Col2A1, MMP9, MMP13, ADAMTS5) and osteogenesis markers (Col10a1, RUNX2 and OCN) after 2-week culture was quantified and compared with RT-PCR. Primer sequences for genes in PCR assay were listed in Supplementary Table 1. Chondrogenesis was determined with alcian blue staining. GAG was quantitatively analyzed (6 vs 6) with normalization to DNA content. GAG content was compared among different treatment groups

microRNA expression and cell transfections

Total RNA was extracted from joint synovial fluid from DDH patients and control using Trizol reagent and then qRT-PCR was conducted with a SYBR Green qPCR Kit and the ABI Detection System. The expressions of miR-454, miR301a, miR301b, miR130a and miR130b were normalized to U6 applying the 2^-ΔΔCt method. The primer details are listed in the supplementary file. MiRNA negative control (mimic control), miR-454 mimics or inhibitors were acquired from GenePharma. Transfection with these reagents was performed using Lipofectamine 3000 according to manufacturer’s protocol.

Statistics

SAS software (version 9.2) was applied to analyze the association between the SNPs and DDH occurrence. Odd ratios (ORs) and 95% confidence interval (CI) were reported. Two-sided chi-squared test was used to confirm the significance of differences in allelic distribution and P<0.05 was considered significantly different. Hardy-Weinberg equilibrium (HWE) was checked with chi-squared test in DDH patients and the control.

Association between FRZB SNPs and the occurrence of DDH

Distribution of loci genotypes in both cases and controls conformed with HWE (p>0.05). Polymorphisms rs3768842 and rs2242070 were selected by Haploview software. Different allele frequency was noted between DDH patients and controls (p<0.05). Detailed distribution of genotype and alleles in DDH patients and healthy control has been listed (Tables 1, 2). An allele of rs3768842 was observed to have a positive association with the risk of DDH (OR=1.29, 95% CI: 1.07-1.56, p=0.0076), while the A allele of rs2242070 was found to have a negative association with the risk of DDH (OR=0.75, 95% CI: 0.62-0.90, p=0.0022). Significant difference was identified for genotype distribution (AA vs AG+GG) for rs3768842 (OR=1.46, 95% CI: 1.10-1.93, p=0.0081). For rs2242070, genotype distribution (AA vs AG+GG) also demonstrated significant difference (OR=0.65, 95% CI: 0.48-0.89, p=0.0067).

Differential FRZB expression was demonstrated in DDH joint tissues

DDH patients showed higher expression of FRZB (Figure 1A) in joint tissue samples compared to the control. (3.72 ± 1.33 vs 6.21 ± 2.35, p = 0.003 for articular cartilage; 2.18 ±0.55 vs. 4.62 ± 1.73, p = 0.004 for joint ligament). Meanwhile, immunofluorescent analysis also showed greater FRZB expression in the DDH tissues. (Figure 1B)

Figure 1. Tissue expression of FRZB in patients and controls. (A) DDH patients were found to have significantly higher expression of the FRZB in the articular cartilage and ligament as compared with the controls (2.43 ± 1.65 vs 4.05 ± 1.89, p = 0.002 for articular cartilage; 2.46 ±1.68 vs. 3.85 ± 2.73, p = 0.007 for joint ligament). (B) Immunofluorescent assay of FRZB (red) expression and nucleus (blue) in the cartilage and ligament tissues in different groups of patients observed under confocal microscopy.

FRZB induced chondrogenesis and Wnt signaling pathway in vitro in BMSCs

Effects of FRZB on chondrogenesis of BMSCs were examined in vitro. (Figure 2) exogenous recombinant FRZB enhanced GAG synthesis BMSCs, while medium supplemented with FRZB antibody decreased GAG deposition (Figure 2A). FRZB induced greater quantity of GAG deposition with higher expression of chondrogenic gene markers in the generated chondrogenic tissue (Figure 2B–2F). As a Wnt antagonist, FRZB blocked Wnt signaling by downregulating the expression of specific Wnt signaling genes (β-catenin, WNT3A and WNT8A). (Figure 3) Moreover, catabolic activities and osteogenesis of BMSCs were inhibited during the chondrogenic process induced by FRZB, indicative of non-hypertrophic chondrocytes induced by exogenous FRZB treatment (Figure 3).

Figure 2. Chondrogenic effects of FRZB on BMSCs in vitro. (A) Alcian blue staining of BMSCs in different treatment groups at 2 weeks to indicate GAG production in the culture plate. (B) Quantification of GAG production in generated cartilaginous tissues (n=6 for each). (C) Immunofluorescent assay of Aggrecan (green) expression and nucleus (blue) in different treatment groups observed under confocal microscopy. (D–F) Expression level of chondrogenic markers for BMSCs in different treatment groups (n=6 for each) in (A) (n=6 for each). *P < 0.05 between control group and other groups. Data are presented as averages ± SD. One-way analysis of variance (ANOVA) with post-hoc Tukey’s B test was applied. Ab, antibody; Exo, exogenous; ACAN, aggrecan; GAG, glycosaminoglycan.

Figure 3. FRZB blocked Wnt signaling and inhibited the catabolic activities and hypertrophy in the induced chondrogenic tissues. (A) Expression level of Wnt pathway markers (β-catenin, WNT3A and WNT8A) for BMSCs in different treatment groups (n=6 for each) (B) Expression level of catabolic markers (MMP9, MMP13 and ADAMTS5) in different treatment groups (n=6 for each). (C) Expression level of hypertrophy and osteogenesis markers (COL10A1, RUNX2 and OCN) for BMSCs in different treatment groups (n=6 for each). *P < 0.05 between control group and other groups. Data are presented as averages ± SD. One-way analysis of variance (ANOVA) with post-hoc Tukey’s B test was applied.

Gene expression profiles in FRZB-knockdown ATDC5 cells

FRZB-knockdown was conducted with FRZB siRNA in chondrogenic progenitor ATDC5 cells. Enrichment of a set of mRNA microarray profiles in FRZB-knockdown ATDC5 cells was compared with control through mRNA sequencing (Figure 4A). Enriched mRNAs were filtered with a log2(fold change) ≥ 2.0 and a false discovery rate (FDR) < 0.05. Specifically, ASPN, COL3A1, CDH13, DKK3, LRRC15 and SFRP4 were up-regulated in FRZB-siRNA group, and ACAN, SOX9, DKK1, ARRB1, ITGAL and CDK1 were down-regulated compared with the control group (Figure 4A). Enrichments of the specific genes with FRZB-knockdown were further validated by qPCR and Western blot experiment, indicating significantly decreased chondrogenesis in FRZB-knockdown ATDC5 cells (Figure 4B, 4C). Gene ontology (GO) categories and KEGG analysis were performed with the differentially enriched mRNAs in FRZB-knockdown cells (Figure 4D, 4E). The enriched genes in FRZB-knockdown ATDC5 cells functioned in many biological processes such as response to stimulus, cell activation, extracellular matrix, cell adhesion molecular binding, signaling receptor binding and integrin binding. KEGG Pathway analysis results were closely associated with cellular adhesion molecules, AGE-RAGE signaling, Wnt signaling and focal adhesion. Protein-protein interaction network was demonstrated for enriched Wnt signaling pathway-related genes with FRZB-knockdown (Figure 4F).

Figure 4. Specific mRNA microarray profiles in FRZB-knockdown ATDC5 cells. (A) The unique enrichment of a set of mRNA microarray profiles in FRZB-knockdown ATDC5 cells compared with control determined by high-throughput sequencing. Differentially enriched mRNAs were filtered with a log2(fold change) ≥ 2.0 and a false discovery rate (FDR) < 0.05. In detail, ASPN, COL3A1, CDH13, DKK3, LRRC15 and SFRP4 were significantly up-regulated in the FRZB-siRNA group, while ACAN, SOX9, DKK1, ARRB1, ITGAL and CDK1 were down-regulated compared with the control group. (B) The enrichments of specific gene expression with FRZB-knockdown were validated by qPCR. * P<0.05 vs. control. (C, D) Western blot experiment validated decreased chondrogenesis in FRZB-knockdown ATDC5 cells. (D, E) GO categories and KEGG pathway analysis were conducted based on the differentially enriched mRNAs in FRZB knockdown cells. The enriched mRNAs in FRZB-knockdown ATDC5 cells were involved in a broad range of biological functions, such as response to stimulus, cell activation, extracellular matrix, cell adhesion molecular binding, signaling receptor binding and integrin binding. KEGG Pathway analysis results were closely associated with cell adhesion molecules, AGE-RAGE signaling pathway, Wnt signaling pathway and focal adhesion. (F) Protein-protein interaction with enriched Wnt signaling pathway-related genes. Abbreviation: GO, gene ontology.

FRZB modulated cell adhesion pathway and cell spreading by regulating integrins expressions

Microarray profiles indicated enriched cell adhesion molecules and signaling in FRZB-knockdown cells (Figure 5A). In previous studies, dysregulated cell adhesion signal has been reported in osteoarthritis development. Taken together, cell adhesion signaling was analyzed in FRZB-knockdown ATDC5. Protein-protein interaction network was derived from the gene expression with enriched cell adhesion molecule and focal adhesion signaling pathway-related genes (Figure 5A). Integrin family members ITGA8 and ITGAV (red arrow) were enriched in both pathways. Western blot experiment further validated ITGA8 and ITGAV expression in FRZB-siRNA group (Figure 5B). Gene expressions of cell adhesion pathway genes were also validated and quantified with RT-PCR, showing significantly enhanced cell adhesion signaling and increased cell size with FRZB knockdown (Figure 5C–5E). Greater cell spreading was demonstrated in FRZB-knockdown cells with cytoskeleton staining (Figure 5D, 5E). To confirm the role of FRZB in cell adhesion and spreading, effects of exogenous FRZB and FRZB blockage on cell spreading was conducted (Figure 5F–5H). Exogenous FRZB significantly inhibited cell spreading while its blockage significantly enhanced cell spreading and increased cell size (Figure 5F). Exogenous FRZB significantly inhibited expression of related genes in cell adhesion signaling pathway while FRZB blockage exerted similar effects to FRZB knockdown in cell adhesion signaling (Figure 5G, 5H).

Figure 5. FRZB modulated cell adhesion pathway and cell spreading by regulating integrins expressions. (A) Protein-protein interaction with enriched cell adhesion molecule and focal adhesion signaling pathway-related genes. Integrin family members ITGA8 and ITGAV (red arrow) were enriched in both pathways. (B) Western blot experiment validated ITGA8 and ITGAV expression in FRZB-siRNA group. (C) Gene expressions of cell adhesion pathway genes were also validated and quantified with RT-PCR. (D, E) Greater cell spreading was demonstrated in FRZB-knockdown cells with cytoskeleton staining (green: phalloidin, blue: nucleus). (F, H) Effects of exogenous FRZB or FRZB blockage on cell spreading and (G) its regulation of related genes in cell adhesion signaling pathway.

Downregulated miRNA-454 expression causes FRZB upregulation in the synovial fluid of DDH patients

Our results had shown that FRZB acted as a pro-chondrogenic gene in multiple DDH joint tissues. Normally, we speculate that miRNAs conveyed in the synovial fluid in the DDH samples might involve in the upregulation of FRZB in the ligament and cartilage tissues. To explore the upstream miRNAs targeting FRZB, we queried the TargetScan, miRmap and miRanda and PITA databases. Five candidates emerged after overlapping potential miRNAs from the four databases (Figure 6A). We measured the expression of the five potential microRNA candidates in synovial fluid from DDH patients and found that miR-454, miR-301a and miR-301b were significantly downregulated in DDH SF compared with normal control samples (Figure 6B). Among the three dysregulated microRNAs, miR-454 was most significantly decreased in DDH SF, so we focused on miR-454 to explore its regulation of FRZB in vitro. Binding sites on FRZB for miR-454 was predicted with targetscan (Figure 6C). Sequence alignment of miR-454 showed high conservation among different species. ATDC5 were transfected with miR-454 mimics, miR-454 inhibitor or their negative control. MiR-454 mimics and inhibitor successfully up or down-regulated miR-454 expression in ATDC5 (Figure 6D). Additionally, PCR results also demonstrated that overexpression with miR-454 mimics could decrease FRZB expression while blockage of miR-454 increased FRZB expression (Figure 6E), indicating that the pro-chondrogenic effects of FRZB overexpression in DDH joint tissues might be mediated by the downregulation of miR-454 in the joint SF.

Figure 6. Downregulated miRNA-454 expression causes FRZB upregulation in the synovial fluid of DDH patients. (A) Five candidate miRNAs emerged after we queried the TargetScan, miRmap and miRanda and PITA databases. (B) Expression of the five microRNA candidates with qRT-PCR in synovial fluid from DDH patients compared with control samples. (C) Binding sites on FRZB for miR-454 (left panel) was predicted with targetscan and sequence alignment of miR-454 (right panel) showed high conservation among different species. (D) miR-454 expression by qRT-PCR in ATDC5 cells (n=6 for each) co-transfected with miR-454 mimics, miR-454 inhibitor or their negative control. (E) PCR results of FRZB expression with MiR-454 mimics and inhibitor in ATDC5.