MAP2K4 interacts with Vimentin to activate the PI3K/AKT pathway and promotes breast cancer pathogenesis

MAP2K4 overexpression promotes cell proliferation, migration, and invasion in breast cancer cells

To investigate the biological role of MA2PK4 in breast cancer cells, lentivirus-carrying MAP2K4 cDNA was infected into MCF-7 and MDA-MB-231 cells (Figure 1A). Real-time quantitative RT-PCR(qRT-PCR) and Western blot respectively verified higher MAP2K4 mRNA and protein expression levels in MCF-7 and MDB-MA-231 cells than in their respective empty vector control cells (Figure 1B).

Figure 1. Overexpression of MAP2K4 promotes cell proliferation, migration, and invasion of breast cancer cells. (A) MCF-7 and MDA-MB-231 cells were transfected with Lv-MAP2K4 and LEV. Green fluorescent protein (GFP) expression was used to monitor the transfection efficiency. (B) MAP2K4 expression measured with qRT-PCR and Western blot following Lv-MAP2K4 overexpression, normalized to GAPDH. Mean ± SD,*P<0.05. MTT assays (C), EdU assays (D), and FCM (E) in MCF-7-Lv-MAP2K4 and MDA-MB-231-Lv-MAP2K4 cells. Mean ± SD *P<0.05; **P<0.01; ***P<0.001. (F) The in vivo MAP2K4 effect was evaluated in xenograft mouse models bearing tumors originating from MCF-7 cells, n=5/group. (G) Representative H&E stained sections with Ki-67 and PCNA IHC staining of primary tumor tissues are shown. Transwell (H) and Boyden assays (I) were performed to measure the effect on invasion and migration in MCF-7-Lv-MAP2K4 and MDA-MB-231-Lv-MAP2K4 cells. Mean ±SD, *P<0.05; **P<0.01.

Subsequently, we examined the effect of MAP2K4 expression on MCF-7 and MDA-MB-231 cell growth using the MTT assay (Figure 1C), EdU staining (Figure 1D), and cell cycle analysis. We found that overexpressed MAP2K4 markedly promoted cell growth and the G1 to S cell-cycle transition in MCF-7 and MDA-MB-231 cells, in vitro (Figure 1E). Finally, we confirmed the effect of MAP2K4 on cell proliferation in vivo by subcutaneously inoculating MAP2K4-overexpressing MCF-7 and MDA-MB-231 cells into nude mice. The average weight and volume of the tumors were noticeably increased in MAP2K4-overexpressing xenograft mice compared with mock xenograft mice (Figure 1F). Furthermore, proliferating cell nuclear antigen (PCNA) and Ki-67 expression as cellular markers for proliferation were ubiquitously higher in tumor tissues with MAP2K4 overexpression compared with those of the control tissues (Figure 1G).

Next, Transwell (Figure 1H) and Boyden (Figure 1I) assays were performed to evaluate the effects of MAP2K4 on metastatic migration and invasion, in vitro. Consistent with the cell proliferation assays above, MAP2K4-overexpressing cell lines promoted invasive and migratory abilities compared with control cells. The results demonstrated that overexpressed MAP2K4 markedly stimulated cell migration and invasion in breast cancer cells.

Silencing of MAP2K4 expression inhibits breast cancer cell proliferation, migration, and invasion

To confirm that MAP2K4 does affect the proliferation, migration, and invasion of breast cancer cells, in vitro, we transiently transfected two siRNA sequences to knockdown MAP2K4 expression in breast cancer cells. We found effective MAP2K4 silencing as identified by qRT-PCR and Western blot (Figure 2A, 2B) in MCF-7 and MDA-MB-231 cells compared with the corresponding control cells without siRNA sequences.

Figure 2. Silencing of MAP2K4 inhibits proliferation, migration, and invasion of breast cancer cells. (A) and (B),Two siRNA sequences were transfected to knockdown MAP2K4 expression in MCF-7 and MDA-MB-231 cells. MAP2K4 expression was detected with qRT-PCR and Western blot in MAP2K4-silenced breast cancer cells, normalized to GAPDH or β-actin. Mean ± SD,**P<0.01. Cell proliferation, migration, and invasion were measured by MTT assays (C), EdU assays (D), Transwell (E) and Boyden assays (F). Mean ± SD, *P<0.05; **P<0.01; ***P<0.001.

In line with our previous studies, we found that siMAP2K4s could notably reverse cell growth stimulation, the G1 to S cell-cycle transition, migration, and invasion of MCF-7 and MDA-MB-231 cells by MTT (Figure 2C), EdU staining (Figure 2D), Transwell (Figure 2E) and Boyden assays (Figure 2F) compared with the control parental lines. These results validated that MAP2K4 might serve as an oncogene in breast cancer.

MAP2K4 activates PI3K/AKT and its downstream cell cycle and EMT signals

To explore the specific molecular mechanisms by which MAP2K4 functions as a breast cancer oncogene, we conducted Western blot analyses to analyze key regulators of the cell cycle and found that MAP2K4 overexpression upregulated cell cycle-related genes including p-PI3K, p-AKT, c-JUN, c-Myc, and Cyclin D1(CCND1) in both MCF-7 and MDA-MB-231 cells. These results suggest that MAP2K4 increased cell growth by activating phosphoinositide-3-kinase (PI3K)/AKT as well as downstream c-JUN and G1/S cell-cycle transition signaling (Figure 3A).

Figure 3. MAP2K4 activates PI3K/AKT and its downstream cell cycle and EMT signals. Western blot analysis of proteins in response to overexpressed MAP2K4 in MCF-7 and MDA-MB-231 cells. (A) PI3K, p-PI3K, AKT, p-AKT, c-JUN, c-Myc and CCND1 protein sequences, (B) the invasion and migration associated proteins, E-cadherin, N-cadherin, Slug, and Vimentin were measured.

Based on the invasion and migration assay results, we examined EMT signals in MAP2K4-overexpressing breast cancer cells and observed that N-cadherin, Vimentin, and Slug were significantly elevated while E-cadherin was decreased, as we expected (Figure 3B).

Suppressing p-PI3K reduces cell proliferation, migration, and invasion of MAP2K4-overexpressing breast cancer cells

In the subsequent study, we suppressed p-PI3K expression using the LY294002 inhibitor (a broad-spectrum inhibitor of PI3K) to further define the specific pathway that MAP2K4 regulates cellular function. Western blots supported its effectively inhibition. Consequently, we explored that suppressing p-PI3K observably weaken cell growth, the G1 to S cell-cycle transition, migration, and invasion in MAP2K4-overexpressing MCF-7 and MDA-MB-231 cells using the MTT assay (Figure 4A), EdU staining (Figure 4B), and the Transwell (Figure 4C) and Boyden assays (Figure 4D) compared with controls. These data showed that p-PI3K plays a critical role in the regulation of cellular function by MAP2K4 in breast cancer.

Figure 4. Inhibiting p-PI3K expression reduces cell proliferation, migration, and invasion in MAP2K4-overexpressing breast cancer cells. MTT assays (A), EdU incorporation assay (B) and Transwell (C) and Boyden assays (D) of breast cancer cells were conducted after inhibiting p-PI3K expression. Mean ± SD, *P<0.05; **P<0.01; ***P<0.001.

Taken together, the results strongly revealed that MAP2K4 promotes cell growth, migration, and invasion via the PI3K/AKT signal pathway.

MAP2K4 interacts with Vimentin

The previous study indicated that a non-invasive breast cancer cell line acquired increased motility and invasiveness upon Vimentin overexpression while the characteristics were down-regulated by silencing of Vimentin in an invasive tumor cell line that constitutively expressed [17]. Through Mass Spectrometry assay in our study, Vimentin was predicted to interact with MAP2K4. Thus, we subsequently conducted Co-immunoprecipitation (CoIP) assay (Figure 5A) to further identify Vimentin coprecipitated with MAP2K4, meanwhile Immuno-fluorescent (IF) staining (Figure 5B) confirmed a common cytoplasm colocalization between MAP2K4 and Vimentin in MCF-7 cells.

Figure 5. MAP2K4 interacts with Vimentin. (A) A Co-immunoprecipitation assay was performed to identify if Vimentin coprecipitated with MAP2K4. (B) MAP2K4-overexpressing MCF-7 cells were subjected to Vimentin immunofluorescent staining to reveal MAP2K4 and Vimentin colocalization.

Vimentin is an EMT-related molecule and high expression in tumors is an important indicator of tumor invasion and metastasis. MAP2K4 can up-regulate Vimentin and interact with Vimentin. Based on these findings, we supposed that MAP2K4 promotes migration and invasion of breast cancer cells by interacting with Vimentin. The experimental results provide insight into the biological significance of the protein-protein interaction of MAP2K4.

Suppressing Vimentin reduces cell proliferation, migration, and invasion in MAP2K4-overexpressing breast cancer cells

To identify if Vimentin was functional, we introduced a siRNA to inhibit the expression of Vimentin in MAP2K4-overexpressing MCF-7 and MDA-MB-231 cells and observed that Vimentin expression was significantly lower in the inhibitor-treated cells than that in the control cells.

Transiently transfecting with siRNA to inhibit Vimentin expression in MAP2K4-overexpressing breast cancer cells reduced cell proliferation by MTT (Figure 6A) and EdU incorporation assays (Figure 6B) as well as inhibited G1 to S cell-cycle transition. For invasion and migration analysis, Vimentin-suppressing breast cancer cells and control parental lines were cultured in Transwells (Figure 6C) and Boyden Chambers (Figure 6D). We found that Vimentin inhibition simultaneously reduced invasive and migratory abilities compared with that of the controls. Finally, we observed that knocking down Vimentin suppressed p-PI3K, p-AKT, c-JUN, c-Myc, and Cyclin D1(CCND1), N-cadherin and restored E-cadherin expression in MAP2K4-overexpressed breast cancer cells (Figure 6E).

Figure 6. Vimentin suppression reduces cell proliferation, migration, and invasion in MAP2K4-overexpressing breast cancer cells. MCF-7-Lv-MAP2K4 and MDA-MB-231-Lv-MAP2K4 cells were transfected with siRNA to inhibit Vimentin expression. Cell growth and cell cycle were measured using the MTT (A) and EdU assays (B). Invasion and migration were measured with the Transwell and Boyden Chamber assays (C, D). Mean ± SD, *P<0.05; **P<0.01; ***P<0.001. (E) Knocking down Vimentin suppressed PI3K/AKT and further modulated its downstream cell cycle and EMT-associated factors in MAP2K4-overexpressing breast cancer cells.

MAP2K4 and Vimentin co-expression is an unfavorable factor in breast cancer

To investigate clinicopathologic correlation, immunohistochemical (IHC) staining was performed to examine MAP2K4 and Vimentin expression patterns in 140 breast cancer specimens concerning several standard clinicopathologic parameters. During a 2-162 month follow-up, 38 patients suffered a recurrence or death with an average survival time of 109.5 months (within the follow-up period), 86.2 months in the MAP2K4 high-expressing group (within the follow-up period), and 125 months in the MAP2K4 low-expressing group (during the follow-up period). In summary, Patients with higher MAP2K4 expression had shorter overall survival time (Figure 7A) (P < 0.001). Meanwhile, we observed that patients with high Vimentin expression had worse prognoses than those with low expression (Figure 7B) (P < 0.05).

Figure 7. Co-expression of MAP2K4 and Vimentin is an unfavorable factor in breast cancer patient prognoses. (A–C) The log-rank test was used to calculate P-values.

The Spearman’s test showed that MAP2K4 expression was positively correlated with Vimentin expression in the breast cancer patients (γ=0.753, P<0.001) (Table 1).

As shown in Table 2, MAP2K4 and Vimentin co-expression levels were positively correlated with the pathologic grade, tumor size, lymph node metastasis presence, and invasion (P<0.001). To further verify the prognostic value of MAP2K4 and Vimentin co-expression in breast cancer patient tissue, we divided 140 cases into four groups based on MAP2K4 and Vimentin expression patterns: (1) MAP2K4 high expression/Vimentin high expression (HH); (2) MAP2K4 high expression/Vimentin low expression (HL); (3) MAP2K4 low expression/Vimentin high expression (LH); and (4) MAP2K4 low expression/Vimentin low expression (LL). Survival curves were constructed using the Kaplan-Meier method and analyzed with the log-rank test. According to the 140 cases with prognostic information, MAP2K4 and Vimentin co-expression levels markedly correlated with overall survival. Patients with high MAP2K4 and Vimentin expression showed the worst prognoses (Mean average survival time 82.3months) compared with those with low expression of MAP2K4 and vimentin or low expression of one or the other (P<0.001). These results indicated MAP2K4 and Vimentin co-expression to be a prognostic predictor of patient survival.

Cell culture

Two breast cancer cell lines (MCF-7 and MDA-MB-231) were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and were cultured in Dulbecco’s modified Eagle medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (FBS; Hyclone, Invitrogen). All cell lines were incubated in a 5% CO₂ humidified chamber at 37°C.

Lentivirus production and infection

Lentiviral particles carrying the MAP2K4 precursor were constructed by GeneChem (Shanghai, China). MCF-7 and MDA-MB-231 cells were infected with the lentiviral vector, and polyclonal cells with green fluorescent protein signals were selected for further experimentation using fluorescence-activated cell sorting (FACS) analysis.

Small-interfering RNA (siRNA) knockdown of MAP2K4 in breast cancer cells

siRNAs for MAP2K4 were designed and synthesized by RiboBio Inc. (Guangzhou, China) Twenty-four hours before transfection, MCF-7 and MDA-MB-231 cells were plated into 6- or 96-well plates (Nest Biotech, China) and cultured to 30–50% confluence. siRNAs (si-MAP2K4-1 or si-MAP2K4-2) or negative control siRNAs (si-NC) were then transfected at a working concentration of 100nM using the Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. MAP2K4 expression was confirmed by qRT-PCR and Western blot analysis.

RNA extraction and qRT-PCR

Total RNA was extracted from the breast cancer cell lines using the Trizol Kit (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions. GAPDH genes were used as internal gene controls. Cycling conditions were 95°C for 10min to activate DNA polymerase, followed by 45 cycles of 95°C for 15s, 60°C for 15s, and 72°C for 10s. Amplification product specificity was confirmed by melting curve analyses. Independent experiments were done in triplicate. Specific sense primers for MAP2K4 and GAPDH are shown as follows: MAP2K4 (Sense 5′-TCCCAATCCTACAGGAGTTCAA-3′, Antisense 5′- CCAGTGTTGTTCAGGGGAGA -3′), GAPDH (Sense5′- TGCACCACCAACTGCTTAGC -3′, Antisense5′- GGCATGGACTGTGGTCATGAG -3′)

Western blot analysis

Total protein extracts were separated by 10% SDS‐PAGE and transferred onto PVDF membranes (Millipore, Bredford). Antibodies included MAP2K4, Vimentin,CCND1, c-JUN, c-Myc, AKT, pAKT (Ser473), PI3K, pPI3K (Tyr458), Slug, E-cadherin and N-cadherin were used in the Western blot analyses according to the manufacturer’s instructions. Detection was performed using the ECL Plus Western blotting detection reagents (Millipore, USA). The specific protein expression levels of the blots were normalized to GAPDH or β-actin.

The cell proliferation assay

The breast cancer cells, MCF-7 and MDA-MB-231 (1,000/well or 2,000/well), were seeded into 96-well plates. For lentivirus-mediated MAP2K4 overexpression, the cells were incubated for 1, 2, 3, 4, 5, 6, or 7 days. For transient transfections with si-MAP2K4, cells were cultured for 1, 2, 3 or 4 days. Subsequently, 20ml of MTT (5mg/ml in PBS) (Sigma, St Louis, MO) solution was added to each well and incubated for 4h. Then, formazan crystals formed by viable cells were solubilized in 150ml dimethyl sulfoxide (Sigma, St Louis, MO) and the absorbance value (OD) was measured at 490nm. All the experiments were repeated at least three times.

Flow cytometric analysis of the cell cycle

For the cell-cycle analysis, a total number of 5×10⁶ breast cancer cells were harvested after a 48h incubation and then washed with cold PBS. The cells were then fixed with 80% ice-cold ethanol at −20°C overnight. After incubation with PBS containing 10mg/ml propidium iodide and 0.5mg/ml RNase A for 15min at 37°C, fixed cells were washed with cold PBS three times. A FACS caliber flow cytometer (BD, Biosciences) was used to measure the DNA content of labeled cells.

The 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay

For the EdU incorporation assay, proliferating breast cancer cells were examined using a Cell-Light EdU Apollo 488 or 567 In Vitro Imaging Kit (RiboBio) according to the manufacturer’s protocol. Briefly, after incubation with 10mM EdU for 2h, breast cancer cells were fixed with 4% paraformaldehyde, permeabilized in 0.3% Triton X-100 and stained with Apollo fluorescent dyes. A total of 5mg/ml of DAPI was used to stain the cell nuclei for 10min. The number of EdU-positive cells was counted under a fluorescent microscope in five random fields. All assays were independently performed three times.

The transwell invasion and migration assays

The invasion and migration assays were performed in a 24-well Transwell chamber with an 8μm pore-size filter membrane (Corning, Inc., New York, NY) coated with or without 50μl Matrigel (1:6 dilution; BD Biosciences). Cells in serum-free medium were seeded in the upper chamber, while conditioned medium with 20% FBS was added to the lower chamber. The chambers were incubated for 14h at 37°C. Non-migrated cells in the upper chamber were removed with cotton swabs, whereas migrated cells on the underside of the filter membrane were fixed in 4% paraformaldehyde and stained with Giemsa. The cell invasion assay procedure was identical to that of cell migration. The migrated/invaded cells were counted by light microscopy. The migration/invasion ability was measured by the mean cell number of five visual fields at a 200× magnification.

In vivo tumorigenesis studies in nude mice

A total of 5×10⁶ logarithmically growing breast cancer cells (MCF-7) overexpressing MAP2K4 and their corresponding control cells were injected into the fourth pair of nude mice breast fat pads (BALB/C, nu/nu, 3–4 weeks-old, female).

The animals were fed an autoclaved laboratory rodent diet. On the 25^th day, the mice were euthanized, and tumor tissues were excised and weighed. All animal studies were conducted in accordance with the principles and procedures outlined in the Southern Medical University Guide for the Care and Use of Animals.

Co-immunoprecipitation (Co-IP)

Co-IP was conducted using the Pierce Co-IP Kit (Thermos Scientific, USA) according to the manufacturer’s instructions. Total proteins were extracted and quantified. A total of 3000μg protein in 400μL supernatant was incubated with 10μg anti-MAP2K4, anti-Vimentin, or anti-IgG antibodies for 12 h at 4 °C. Beads were washed, eluted in a sample buffer, and boiled for 10 min at 100 °C. Immune complexes were subjected to Coomassie Brilliant Blue staining and Western blot analysis. Anti-IgG was used as a negative control.

The confocal assay

MCF-7 cells were co-transfected with the MAP2K4 and Vimentin plasmids in a six-well plate. Cells were cultured overnight before they were fixed with 3.5% paraformaldehyde and permeabilized with 0.2% Triton X-100 at room temperature. The cells were incubated with anti-MAP2K4 and anti-Vimentin vimentin antibodies for 30–45 min at 37°C. After incubation for 30-45 min at 37 °C with a secondary antibody, coverslips were mounted onto the slides with a mounting solution containing 0.2mg/mL DAPI. Images were captured by laser scanning and confocal microscopy (ECLIPSE-Ti, Nikon).

Immunohistochemical staining

Tissue sections from the in vivo experiments were used to detect Ki-67 and PCNA protein expression levels using immunohistochemistry. The indirect streptavidin-peroxidase method was used according to the manufacturer’s introduction. Immunohistochemically stained tissue sections were examined separately by two pathologists. The antibodies used were rabbit anti-PCNA (Cat. No.10205-2-AP, 1:30, Proteintech), anti-Ki67 (Cat. No. Ab16667, 1:100, Abcam).

Paraffin tissue arrays of breast cancer (HBre-Duc140Sur-01) was purchased from Shanghai Outdo Biotech (Shanghai Outdo Biotech Co., Shanghai, China). Tissue sections stained immunohistochemically for MAP2K4 and Vimentin were reviewed, and cytoplasmic staining scored separately by two pathologists blinded to the clinical parameters. The extent of staining, defined as the percentage of positively staining tumour cells in relation to the whole tissue area, was scored on a scale of 0-4 as follows: 0, <10%; 1, 10-25%; 2, 26-50%; 3, 50-75%; and 4, >75%. The staining intensity was scored as 0-3(Negative:0; Weak expression: 1; Positive expression:2; Strong expression:3; The sum of the staining intensity and staining extent scores was used as the final staining score for MAP2K4 and Vimentin(0-7). For statistical analysis, final staining scores of 0–5 and 6–7 were considered to respectively show low and high expression.

Statistical analysis

Statistical analyses were performed with the SPSS 13.0 statistical software package (SPSS Inc. Chicago, IL, USA). Data are expressed as the mean ± SD from at least three independent experiments. Two-tailed Student’s t-test was used for comparisons between groups. Associations between MAP2K4 and Vimentin were analyzed using the Spearman’s correlation coefficient. Survival analysis was performed using the Kaplan–Meier method. All statistical tests were two-sided, and single, double, and triple asterisks indicate statistical significance(*P<0.05, **P<0.01 and ***P<0.001).